DETAILED VIEW
VDRC ID 330262
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG8024
FlyBase gene number FBgn0015788
FBgn0062240
FBgn0002567
Synonyms 24652026
24652028
A1Z7S1
anon-WO0118547.106
beck
DmRab32
DRABR1
DrabRP1
lightoid
Lightoid
ltd
rab32
Rab32
Rab32/RP1
Rab7L1
Rab-r1
Rab-related protein 1
RabRP1
Rab-RP1
RAB-RP1
Rab-RP1/CG8024
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGCAAGTGGAAGGAAGATCTA
21bp Sequence
(antisense)
TAGATCTTCCTTCCACTTGCT
Hairpin Length 71
Sequence ctagcagtAGCAAGTGGAAGGAAGATCTAtagttatattcaagcataTAGATCTTCCTTCCACTTGCTgcg
Category shRNA stocks