DETAILED VIEW
VDRC ID 330230
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG40411
FlyBase gene number FBgn0046268
FBgn0039998
FBgn0058411
FBgn0039975
FBgn0010247
Synonyms BEST:LD21673
CG17685
CG17696
CG17718
dmparp
Dm.pARTa
dPARP
D.PARP
LD21673.3prime
parp
Parp
PARP
Parp1
PARP1
PARP-1
poly ADP ribose polymerase
poly-(ADP-ribose) polymerase
poly(ADP-ribose) polymerase
Poly-(ADP-ribose) polymerase
Poly(ADP-ribose) polymerase
Poly(ADP-)Ribose Polymerase
Poly(ADP)-Ribose Polymerase
Poly(ADP ribose) polymerase 1
Poly(ADP-ribose) Polymerase 1
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGCTCAGTAGGAGACATACAA
21bp Sequence
(antisense)
TTGTATGTCTCCTACTGAGCT
Hairpin Length 71
Sequence ctagcagtAGCTCAGTAGGAGACATACAAtagttatattcaagcataTTGTATGTCTCCTACTGAGCTgcg
Category shRNA stocks