DETAILED VIEW
VDRC ID 330203
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG1794
FlyBase gene number FBgn0033438
FBgn0061593
FBgn0010512
Synonyms 2-MMP
anon-WO0118547.84
dm-2MMP
Dm2-MMP
dmmp2
l(2)02353
matrix metalloprotease 2
matrix metalloproteinase
Matrix metalloproteinase
Matrix metalloproteinase 2
mmp2
Mmp2
MMP2
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGGATGCTGTATACGAAAACA
21bp Sequence
(antisense)
TGTTTTCGTATACAGCATCCA
Hairpin Length 71
Sequence ctagcagtTGGATGCTGTATACGAAAACAtagttatattcaagcataTGTTTTCGTATACAGCATCCAgcg
Category shRNA stocks