DETAILED VIEW
VDRC ID 330185
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG1070
FlyBase gene number FBgn0037471
FBgn0062159
FBgn0011412
FBgn0261238
FBgn0003528
FBgn0011439
Synonyms AF10
Alh
alhambra
Alhambra
ALHAMBRA
anon-WO0118547.226
dAF10
Dalf
l(3)84Be
l(3)g2
l(3)g5
l(3)j13A6
l(3)j8c8
l(3j8C8
l(3)j8C8
l(3)r13
sticking
stk
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGGTCTGAAGTTTACCTACGA
21bp Sequence
(antisense)
TCGTAGGTAAACTTCAGACCA
Hairpin Length 71
Sequence ctagcagtTGGTCTGAAGTTTACCTACGAtagttatattcaagcataTCGTAGGTAAACTTCAGACCAgcg
Category shRNA stocks