DETAILED VIEW
VDRC ID 330155
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG8107
FlyBase gene number FBgn0025866
Synonyms calpainB
calpain B
Calpain B
Calpain-B
calpB
CalpB
CALPB
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TGGCGCGTTCACCACATTTTA
21bp Sequence
(antisense)
TAAAATGTGGTGAACGCGCCA
Hairpin Length 71
Sequence ctagcagtTGGCGCGTTCACCACATTTTAtagttatattcaagcataTAAAATGTGGTGAACGCGCCAgcg
Category shRNA Stocks