DETAILED VIEW
VDRC ID 330148
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG7446
FlyBase gene number FBgn0001134
Synonyms CT22917
DmGABA(GRD)
GABA and glycine-like receptor of Drosophila
GABA-and-glycine-receptor-like-subunit-of-Drosophila
GABA/Glycine-gated chloride channel-like
Glycine receptor
Grd
GRD
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGAGCTATTTGCACACGATTA
21bp Sequence
(antisense)
TAATCGTGTGCAAATAGCTCT
Hairpin Length 71
Sequence ctagcagtAGAGCTATTTGCACACGATTAtagttatattcaagcataTAATCGTGTGCAAATAGCTCTgcg
Category shRNA Stocks