DETAILED VIEW
VDRC ID 330111
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4379
FlyBase gene number FBgn0000273
FBgn0010695
FBgn0000353
Synonyms 6353
C
cAMP-dependent protein kinase
cAMP-dependent protein kinase 1
catalytic subunit of cAMP-dependent protein kinase
catalytic subunit of PKA
CdkA
Cos
cos1
Cos1
Cos-1
Costal
costal-1
Costal-1
Dc0
DC0
dco
dcO
Dco
DCO
Dcpk
dPKA
l(2)01272
l(2)cos[[1]]
l(2)s4402
pka
pkA
pKA
Pka
PKA
Pka-C
PKAc
pka-c1
pka C1
pka-C1
PkaC1
Pka-C1
PKAC1
PKA-C1
PKAcA
PKA catalytic subunit
PKA CI
PKA Cl
protein kinase A
Protein kinase A
Protein Kinase A
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGACTGGATTGCGATCTTCCA
21bp Sequence
(antisense)
TGGAAGATCGCAATCCAGTCG
Hairpin Length 71
Sequence ctagcagtCGACTGGATTGCGATCTTCCAtagttatattcaagcataTGGAAGATCGCAATCCAGTCGgcg
Category shRNA Stocks