DETAILED VIEW
VDRC ID 330104
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG3820
FlyBase gene number FBgn0010660
FBgn0034798
Synonyms CAN
CAN/Nup214
dCAN
DCAN
DNup214
l(2)10444
Nucleoporin 214
Nucleoporin 214kD
Nup
nup214
Nup214
Nup 214
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CCACAAGATTGTTGCGTTCAA
21bp Sequence
(antisense)
TTGAACGCAACAATCTTGTGG
Hairpin Length 71
Sequence ctagcagtCCACAAGATTGTTGCGTTCAAtagttatattcaagcataTTGAACGCAACAATCTTGTGGgcg
Category shRNA Stocks