Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 330087
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG31646
FlyBase gene number FBgn0031727
FBgn0040948
FBgn0051646
Synonyms
31646
CG14008
CG14009
CT33566
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
TGATGTGAAGGAGTCCGATAA
21bp Sequence
(antisense)
TTATCGGACTCCTTCACATCA
Hairpin Length 71
Sequence ctagcagtTGATGTGAAGGAGTCCGATAAtagttatattcaagcataTTATCGGACTCCTTCACATCAgcg
Category shRNA Stocks