DETAILED VIEW
VDRC ID 330085
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG3131
FlyBase gene number FBgn0031464
Synonyms dduox
dDuox
dual oxidase
Dual oxidase
duox
Duox
DUOX
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGACTACGAGATGCCGATAGA
21bp Sequence
(antisense)
TCTATCGGCATCTCGTAGTCG
Hairpin Length 71
Sequence ctagcagtCGACTACGAGATGCCGATAGAtagttatattcaagcataTCTATCGGCATCTCGTAGTCGgcg
Category shRNA Stocks