DETAILED VIEW
VDRC ID 330053
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG17246
FlyBase gene number FBgn0003347
FBgn0261439
FBgn0017539
Synonyms COMPLEX II: flavoprotein subunit
scs-fp
Scs-fp
sdh
Sdh
SDH
Sdha
SdhA
succinate dehydrogenase
Succinate dehydrogenase
Succinate dehydrogenase A
Succinate dehydrogenase Flavoprotein
succinate dehydrogenase flavoprotein subunit
Succinate dehydrogenase Flavoprotein subunit
succinyl CoA synthetase flavoprotein subunit of complex II
SUCCINYL COENZIME A SYNTHETASE FLAVOPROTEIN SUBUNIT
Succinyl coenzyme A synthetase flavoprotein subunit
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
CGGAGACATTACGCTGGACTA
21bp Sequence
(antisense)
TAGTCCAGCGTAATGTCTCCG
Hairpin Length 71
Sequence ctagcagtCGGAGACATTACGCTGGACTAtagttatattcaagcataTAGTCCAGCGTAATGTCTCCGgcg
Category shRNA Stocks