DETAILED VIEW
VDRC ID 330039
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG14994
FlyBase gene number FBgn0001110
FBgn0001088
FBgn0016015
FBgn0004516
Synonyms dgad1
dGad1
DGad1
DGAD1
GABA synthetase
gad
Gad
GAD
gad1
Gad1
GAD1
GAD-1
GAD[[1]]
Glb
glutamatic acid decarboxylase
glutamic acid decarboxylase
Glutamic acid decarboxylase
glutamic acid decarboxylase-1
Glutamic acid decarboxylase 1
Glutamic acid decarboxylase-1
l(3)64An
l(3)SH10
vesicular glutamic acid decarboxylase
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TCACAAGATGTTCCCGAACTA
21bp Sequence
(antisense)
TAGTTCGGGAACATCTTGTGA
Hairpin Length 71
Sequence ctagcagtTCACAAGATGTTCCCGAACTAtagttatattcaagcataTAGTTCGGGAACATCTTGTGAgcg
Category shRNA Stocks