DETAILED VIEW
VDRC ID 330033
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG1395
FlyBase gene number FBgn0011354
FBgn0011428
FBgn0011019
FBgn0003525
FBgn0011315
FBgn0043376
FBgn0011317
Synonyms 0224/06
0245/03
0439/22
0730/13
0896/05
0967/05
0980/06
1083/13
1089/08
1143/02
5473
anon-EST:Liang-2.21
cdc25
Cdc25
CDC25
Cdc25c
Cdc25[stg]
Cdc25[Stg]
cdc25/string
cdc25[string]
Cdc25[string]
Cdc25[String]
CDC25[string]
clone 2.21
EP1213
l(3)01235
l(3)j10B9
l(3)j1D3
l(3)j1E3
l(3)j3D1
l(3)s2213
S(rux)3A
st
stg
Stg
STG
stg[cdc25]
str/cdc25
string
String
string/cdc25
String/Cdc25
String/Cdc25 phosphatase
Suppressor of rux 3A
SY3-4
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
CGAGATCTATCTGCTGCACAA
21bp Sequence
(antisense)
TTGTGCAGCAGATAGATCTCG
Hairpin Length 71
Sequence ctagcagtCGAGATCTATCTGCTGCACAAtagttatattcaagcataTTGTGCAGCAGATAGATCTCGgcg
Category shRNA Stocks