DETAILED VIEW
VDRC ID 330029
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG13586
FlyBase gene number FBgn0046758
FBgn0035023
Synonyms BcDNA:SD05282
chgh
CHH-like
DrmITP
Drm-ITP
DrmITPL1
DrmITPL2
ion transport peptide
Ion transport peptide
ion transport polypeptide
itp
Itp
ITP
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGACGAGTATACACCGATTAT
21bp Sequence
(antisense)
ATAATCGGTGTATACTCGTCT
Hairpin Length 71
Sequence ctagcagtAGACGAGTATACACCGATTATtagttatattcaagcataATAATCGGTGTATACTCGTCTgcg
Category shRNA Stocks