DETAILED VIEW
VDRC ID 330023
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG12073
FlyBase gene number FBgn0004573
Synonyms 5HT7
5-HT7
5-HT[[7]]
5HT-7
5-HT7Dro
5-HT[[7]]Dro
5-HT[[7Dro]]
5-HT[7]Dro
5HT[[7Dro]]
5-HT-dro
5HT-dro
5-HTdro1
5-HT-dro1
5-HT[[dro1]]
5HT-dro1
5htdror
5HT-R1
5-hydroxytryptamine (serotonin) receptor 7
Dm5HTdro1
DRO1
Serotonin receptor
Serotonin receptor 1
Serotonin receptor 7
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGGATTGTCCTGGAAGAGAAA
21bp Sequence
(antisense)
TTTCTCTTCCAGGACAATCCG
Hairpin Length 71
Sequence ctagcagtCGGATTGTCCTGGAAGAGAAAtagttatattcaagcataTTTCTCTTCCAGGACAATCCGgcg
Category shRNA Stocks