DETAILED VIEW
VDRC ID 330009
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10763
FlyBase gene number FBgn0030011
Synonyms Gbeta
G[[beta]]
Gbeta5
G[[beta5]]
Gbeta 5
Gbetagamma
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGCGAGCAATGCGAACGCGAA
21bp Sequence
(antisense)
TTCGCGTTCGCATTGCTCGCT
Hairpin Length 71
Sequence ctagcagtAGCGAGCAATGCGAACGCGAAtagttatattcaagcataTTCGCGTTCGCATTGCTCGCTgcg
Category shRNA Stocks