DETAILED VIEW
VDRC ID 31198
Library GD Stocks (GD)
Construct ID 6897
CG Number (r6.01) CG10198
FlyBase gene number FBgn0039119
FBgn0021781
FBgn0039120
Synonyms CG10201
l(3)95BCd
Nucleoporin 98
nucleoporin98-96
Nucleoporin 98-96
Nucleoporin 98-96kD
Nup
nup145
Nup96
Nup 96
Nup96-98
Nup98
Nup 98
Nup-98
NUP98
nup98-96
Nup98-96
Nup98/96
Nup98-Nup96
Hairpin Length 380
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCATCCTCCACCGTTCGCCTCT
Right Primer GCGTCTAGAGCCAGCCACATCCATTTCCTTG
Template genomic
Sequence CATCCTCCAC CGTTCGCCTC TCGGTGTCAA CCATCCCAGA GAATCCATTT GAGGATCAAT CCAGCACCAT TGCACGTCGC GAAACCTTCA CTTCGCAGCA GGCCAATGAG AGTGTGCTTT CGAACAGATC TAATGAGGCA GAGGACTCTG CAGCAAACCA ATCCCGCCTA GCCATTGAGG CAGCTGCTGC AGAGGCAGCA GACGACGAAT CACATCCAAC AGGCATTGTG CTGCGACGCG TGGGTTACTA TACAATTCCA TCGCTAGACG ACCTACGCTC CTATCTGGCC GAGGACGGAT CCTGTGTGGT TCCGAACTTT ACGGTGGGTC GGGAAGGATA CGGCAATGTC TTCTTCGGCA AGGAAATGGA TGTGGCTGGC