DETAILED VIEW
VDRC ID 30709
Library GD Stocks (GD)
Construct ID 5048
CG Number (r6.01) CG8068
FlyBase gene number FBgn0003612
FBgn0010550
Synonyms CLOT2057
DmPias
dpias
dPIAS
Dpias
DPIAS
i184
l(2)03697
pias
PIAS
protein inhibitor of activated STAT
suppressor of variegation 2-10
Suppressor of variegation 2-10
Su(var)-10
Su-var(2)10
Su(var)2-10
Suvar(2)10
Su(Var)2-10
SU(VAR)2-10
zimp
ZIMP
ZimpA
ZimpB
zinc finger-containing Miz1 PIAS3-like
Hairpin Length 352
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 4
Viability lethal
Inserted Chromosome 3
Left Primer CGCGAATTCTGGTGCAGATGCTTCGAGTGGT
Right Primer GCGTCTAGATGGCTGTTGATGCTGTGTGTGTG
Template genomic
Sequence TGGTGCAGAT GCTTCGAGTG GTCGAGCTGC AAAAAATCCT GTCGTTTCTG AACATCTCAT TCGCTGGACG AAAAACTGAC CTGCAGAGCC GCATCCTCTC GTTCTTGCGC ACCAACTTGG AACTGCTTGC CCCGAAGGTC CAGGAAGTCT ACGCCCAGTC CGTGCAGGAA CAAAACGCCA CGCTGCAGTA CATCGACCCA ACCAGGATGT ACTCGCACAT CCAGCTGCCG CCCACCGTGC AGCCCAATCC CGTGGGCCTC GTGGGCAGCG GCCAAGGTGT GCAAGTGCCC GGCGGCCAGA TGAATGTGGT CGGCGGCGCA CCCTTCCTCC ACACACACAG CATCAACAGC CA