DETAILED VIEW
VDRC ID 30404
Library GD Stocks (GD)
Construct ID 3990
CG Number (r6.01) CG5014
FlyBase gene number FBgn0029687
FBgn0040184
FBgn0025953
FBgn0066853
FBgn0062492
Synonyms anon-EST:Liang-2.42
anon-WO03040301.124
BcDNA:GM03307
clone 2.42
dVAP
DVAP
dvap33a
dVAP33A
DVAP33A
DVAP-33A
l(1)G0231
VAMP-associated protein of 33kDa A
VAMP-associated protein of 33kDa ortholog A
VAP
VAP-33
vap33-1
Vap-33-1
Vap33-1
VAP-33-1
vap-33A
Vap-33A
VAP33-A
VAPB
Hairpin Length 310
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCCTTCACCCGACCCGTTGT
Right Primer CGCTCTAGACGCACTTCAGTTTGGCGTCCAT
Template cDNA
Sequence CCCTTCACCC GACCCGTTGT CACAATCATG ACTCTGCGCA ACAACTCGGC TCTGCCTCTG GTCTTCAAGA TCAAGACAAC CGCCCCGAAA CGCTACTGCG TACGTCCAAA CATCGGCAAG ATAATTCCCT TTCGATCAAC CCAGGTGGAG ATCTGCCTTC AGCCATTCGT CTACGATCAG CAGGAGAAGA ACAAGCACAA GTTCATGGTG CAGAGCGTCC TGGCACCCAT GGATGCTGAT CTAAGCGATT TAAATAAATT GTGGAAGGAT CTGGAGCCCG AGCAGCTGAT GGACGCCAAA CTGAAGTGCG