DETAILED VIEW
VDRC ID 30033
Library GD Stocks (GD)
Construct ID 14981
CG Number (r6.01) CG2759
FlyBase gene number FBgn0026792
FBgn0026850
FBgn0003996
FBgn0000561
Synonyms BACN33B1.1
c23
DMWHITE
e(g)
EG:BACN33B1.1
enhancer of garnet
Hid
m(g)
mini-white
modifier of garnet
mw
w
W
w(AT)[[13]]
white
white[+]
Hairpin Length 336
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCAAGGAGATGCAGGCCAGGT
Right Primer GCGTCTAGACGACGCTGTGGGCGGTAAAG
Template genomic
Sequence CCAAGGAGAT GCAGGCCAGG TGCGCCTATG TCCAGCAGGA TGACCTCTTT ATCGGCTCCC TAACGGCCAG GGAACACCTG ATTTTCCAAG CCATGGTGCG GATGCCACGA CATCTGACCT ATCGGCAGCG AGTGGCCCGC GTGGATCAGG TGATCCAGGA GCTTTCGCTC AGCAAATGTC AGCACACGAT CATCGGTGTG CCCGGCAGGG TGAAAGGTCT GTCCGGCGGA GAAAGGAAGC GTCTGGCATT CGCCTCCGAG GCTCTAACCG ATCCGCCGCT TCTGATCTGC GATGAGCCCA CCTCCGGACT GGACTCCTTT ACCGCCCACA GCGTCG