DETAILED VIEW
VDRC ID 29619
Library GD Stocks (GD)
Construct ID 15002
CG Number (r6.01) CG1560
FlyBase gene number FBgn0027260
FBgn0025177
FBgn0001811
FBgn0001448
FBgn0029991
FBgn0020759
FBgn0004657
FBgn0028333
FBgn0002992
Synonyms beta1
beta1 integrin
beta-int
betaInt
beta-Int
beta integrin
beta-integrin
betaIntegrin
beta-Integrin
betamys
beta[[mys]]
beta[[mys]]-integrin
betaPS
beta-PS
beta[[P]]S
beta[[PS]]
BetaPS
betaPS1
beta-PS1 integrin
betaPS Int
BetaPS-Int
betaps-integrin
beta PS integrin
beta-PS integrin
beta[[PS]] integrin
beta[[PS]]-integrin
betaPS integrin
betaPS-integrin
betaPS.*integrin
beta-PS Integrin
beta-PS-Integrin
betaPS-Integrin
BetaPS integrin
beta[[PS]] integrin subunit
bPS
b[[PS]]
CT40473
EM28
Integrin
integrinbeta
integrin beta[[PS]]
integrin-betaPS
Integrin betaPS
Integrin-betaPS
integrin beta[[PS]] subunit
Integrin betaPS subunit
integrin PSbeta
ItgbetaPS
l(1)7Db
l(1)7Dn
l(1)93p
l(1)968
l(1)DA551
l(1)EM28
l(1)G0233
l(1)G0281
l(1)mys
lethal(1)93 pupal
lethal(1)myospheroid
lethal myospheroid
MAb6G11
myospheriod
Myospheriod
myospheroid
myo-spheroid
Myospheroid
mys
Mys
nj42
non-jumper-42
olfactory C
olfactory-C
olfC
PS
PSbeta
PS[[beta]]
PS-beta-integrin
PSbeta-integrin
PS integrin beta subunit
Hairpin Length 399
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCTGCCACAAGCGACCAAATCC
Right Primer GCGTCTAGAGGCGCAATCATCACCGTTCTT
Template genomic
Sequence TGCCACAAGC GACCAAATCC CATTGAGATC ATATCCGGTA AACACTGCGA GTGCGACAAC TTCAGCTGCG AACGGAACAG GAACCAGTTG TGCTCGGGTC CCGATCACGG TACATGCGAG TGCGGCCGTT GCAAATGCAA GCCAGGCTGG ACGGGCTCCA ATTGCGGCTG CCAGGAGTCC AACGATACAT GTATGCCACC TGGAGGCGGC GAGATCTGCT CCGGTCATGG TACCTGCGAA TGCGGTGTCT GCAAGTGTAC GGTTAACGAT CAGGGACGCT TCTCGGGCCG ACATTGCGAG AAGTGTCCAA CTTGCTCGGG CAGGTGCCAG GAGCTGAAGG ATTGTGTCCA GTGCCAGATG TACAAGACGG GCGAGCTGAA GAACGGTGAT GATTGCGCC