DETAILED VIEW
VDRC ID 2919
Library GD Stocks (GD)
Construct ID 1390
CG Number (r6.01) CG9653
FlyBase gene number FBgn0024250
Synonyms brinker
Brinker
brk
Brk
Dm brk
small salivary glands-1
ssg-1
Hairpin Length 292
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCTCGTCAGCCAGTCACATTCCACA
Right Primer CGCTCTAGACCACCTCCACATCCTCGTTCTCC
Template genomic
Sequence TCGTCAGCCA GTCACATTCC ACATGTGCCC TTTGCCTACC ATCACAATCT GCATGGCTAT TTGGAGAATC GACTGGAGGC GGTTGCCACA CCAGCCCCCA TGGACCTCTC TCTCGGATCC TCTGCCCGCC GTCAAATGCA GTTGCACGAA AAGGATCCAT CTGGTGTGGA TCTCACTTTC CGCAAACGTA AGGTCATCAC TAGTCCGATG CAGCCGGATA AGATTAGTAA GCTGGAGGAG GTGATCAAGA AGGAGCCCGA AACGGAAACG GAGAACGAGG ATGTGGAGGT GG