DETAILED VIEW
VDRC ID 2861
Library GD Stocks (GD)
Construct ID 696
CG Number (r6.01) CG3856
FlyBase gene number FBgn0040576
FBgn0024944
Synonyms CG15698
Dmoa1
DmOAMB
Dm-OAMB
DmOCT1B
DmOctalpha1Rb
GPCR
oamb
Oamb
OAMB
OAMB-1a
Oamb a
OAMB-AS
Oamb b
OAMB-K3
octopamine-activated G-protein-coupled receptor
octopamine mushroom body receptor
octopamine receptor
Octopamine receptor in mushroom bodies
octopamine receptor OAMB
OctR
OctR1
Hairpin Length 240
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCATGAATGAAACAGAGTGCGAGGATCT
Right Primer CGCTCTAGACCAGGTGGCTGAGAAGGGTAGG
Template genomic
Sequence ATGAATGAAA CAGAGTGCGA GGATCTCATC AAATCTGTGA AATGGACGGA ACCAGCCAAT CTGATCTCCC TGGCCGTACT CGAGTTCATC AACGTTCTGG TCATCGGTGG CAACTGCCTC GTGATTGCCG CCGTCTTCTG TTCGAATAAG TTGAGGAGTG TGACGAACTT CTTTATTGTC AACCTAGCTG TGGCCGATCT TCTGGTGGGT TTGGCCGTCC TACCCTTCTC AGCCACCTGG