DETAILED VIEW
VDRC ID 26562
Library GD Stocks (GD)
Construct ID 11367
CG Number (r6.01) CG4600
FlyBase gene number FBgn0032158
FBgn0040064
Synonyms ACAA
acetyl-CoA acyltransferase
yip2
Yip2
yippee interacting protein 2
Hairpin Length 349
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 0
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCAGCCCGCCCTTGGAATCAAC
Right Primer GCGTCTAGAAATGCTCCCTCCTTCTGACCCTTCT
Template genomic
Sequence AGCCCGCCCT TGGAATCAAC CGGCTTTGCG GTTCCGGCTT CCAGTCGATC GTAAACGGAG CCCAGGACAT CCTGGTCGGC GGTGCCAAGA TAGCCCTTAC CGGCGGCGTG GAGAACATGT CACAGAGCCC TTTCATTGCC CGTAATGTGA GATTCGGAAC CACCTTGGGT GCCAGCTACA ATCTGGAGGA TGCTCTATGG GCTGGCCTCA CCGATACCTA CTGCAAGCTG CCCATGGCTC TGACCGCTGA GAACCTGGCC GATCAGTACA AGATCAGTAG GGAGCGTGTG GATGAGTTCT CTCTGCTCTC GCAAAAGAAC TGGGAGAAGG GTCAGAAGGA GGGAGCATT