DETAILED VIEW
VDRC ID 26504
Library GD Stocks (GD)
Construct ID 11281
CG Number (r6.01) CG4311
FlyBase gene number FBgn0034115
FBgn0034116
FBgn0010611
FlyBase recombinant construct FBtp0024721
FlyBase Reference Reports FBrf0200327
FBrf0214431
FBrf0214518
FBrf0202579
Synonyms CG16796
HMG-CoA synthase
HMG Coenzyme A synthase
Hmgs
HMGS
hydroxy-3-methylglutaryl-CoA synthase
l(2)06214
Ov25
Hairpin Length 359
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 1
Left Primer CGCGAATTCGCGGGTGCTGTGGCTATGCT
Right Primer GCGTCTAGATGCTTCGTTCGCTCCTCCTCAC
Template genomic
Sequence GCGGGTGCTG TGGCTATGCT GGTGGGTCCA AATGCGCCGC TTATCCTCGA TCGTGGACTA CGCGCAACGC ACATGGAGCA CGCCTACGAC TTTTACAAGC CGGACCTCAG CTCCGAATAC CCAACGGTAG ATGGAAAGCT CTCTATTCAG TGCTACCTTT CTGCTCTGGA CACCTGCTAC AGGCTGTATC GCAAGAAGTT CGACCAGCAG CAGAAGGATA CTTCCAAGCA GCCGGCCAGC CTGAGCACCT TCGATGCTAT CCTATTCCAC ACACCGTTCT GCAAGTTGGT GCAAAAATCT GTGGGTCGCC TGAGCTTCAA CGATTTCCTG CTGAGCAGTG AGGAGGAGCG AACGAAGCA