DETAILED VIEW
VDRC ID 25483
Library GD Stocks (GD)
Construct ID 9902
CG Number (r6.01) CG5991
FlyBase gene number FBgn0026576
FBgn0039143
Synonyms
BEST:LD21713
LD21713
Phosphatidylserine decarboxylase
Psd
Hairpin Length 395
ON Targets 1
OFF Targets 1
s19 0.99
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCTGGAGACTGTGGAGCAGGCAAA
Right Primer CGCTCTAGAGTCGTAGGTGCTGGGCGGATG
Template genomic
Sequence CTGGAGACTG TGGAGCAGGC AAATTCCGGT GCCTCCTATG CCCAGGCCCT CAAAAAGAAG AGCGATGGTT CTACGGAGCT GTACCAGTGC GTGATATATC TGGCTCCCGG AGATTACCAT CGATTCCACT CTCCTACCGC TTGGAAGCCC ACCATTCGTC GTCACTTCTC CGGCGAACTG CTGTCCGTGA GCCCCAAAGT TGCCGGCTGG CTGCCTGGTC TGTTTTGCCT CAACGAACGT GTGCTGTACA TGGGCCAGTG GAAGCACGGA TTCTTCTCCT ACACCGCCGT GGGTGCCACA AACGTGGGAT CCGTCGAAAT CTACATGGAT GCCGATCTGA AGACGAACCG TTGGACTGGA TTCAATGTCG GCAAGCATCC GCCCAGCACC TACGA