DETAILED VIEW
VDRC ID 24473
Library GD Stocks (GD)
Construct ID 16
CG Number (r6.01) CG8595
FlyBase gene number FBgn0034476
Synonyms CT24947
dTLR7
dToll7
Tl-7
toll
Toll-7
TOLL 7
Toll-like
toll receptor
Hairpin Length 198
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 3
Left Primer CGCTCTAGATGCTCCTGCTCGGGTTCTCCT
Right Primer CGCGAATTCCACTGGGTTGCGATGGATTGG
Template genomic
Sequence TGCTCCTGCT CGGGTTCTCC TGGAGTCTCG CGGTCGAGTC CGCACTGGCG CCCAAGGAGA GCGAATCGAG TGCCAGCGCC ATGTTAGGCG CCGGAACAGG AGCCGCTGCC ACAGTATCGC TATCAGGCGA CTACTCCTCG CTGCTGTCCA ATGTGCCGGC CGCCTCGCCG GTTCCGGCCA ATCCATCGCA ACCCAGTG