DETAILED VIEW
VDRC ID 22007
Library GD Stocks (GD)
Construct ID 11542
CG Number (r6.01) CG5119
FlyBase gene number FBgn0265297
FBgn0003031
FBgn0027713
FBgn0063151
FBgn0027714
FBgn0261619
FBgn0021963
FBgn0040739
FBgn0065324
FBgn0025217
Synonyms
anon-EST:fe2E5
anon-EST:Posey247
anon-EST:Posey249
anon-fast-evolving-2E5
BcDNA:LD24412
CG16803
doppio fuso
dPABP
duo
l(2)k10109
l(2)SH1908
l(2)SH2 1908
lethal (2) SH1908
pAB
pabp
pAbp
pABP
Pabp
PAbp
PABP
PABP55B
PABPC1
poly (A)-binding protein
poly-A binding protein
poly(A) binding protein
poly(A)-binding protein
polyA-binding protein
Poly(A) binding protein
Poly(A)-binding protein
Poly(A)binding protein
polyadenylate-binding protein
Hairpin Length 364
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCAAGGAGGATGGCAAGAGCAA
Right Primer GCGTCTAGAGCGGCATTGAAGCACACGAA
Template genomic
Sequence CCAAGGAGGA TGGCAAGAGC AAGGGCTTCG GATTCGTTGC ATTCGAGACA ACAGAGGCTG CTGAGGCGGC CGTTCAGGCT CTCAATGGCA AGGACATGGG AGAGGGCAAG TCCCTGTACG TGGCTCGTGC CCAGAAGAAG GCCGAACGCC AGCAGGAGCT GAAGCGCAAG TTCGAGGAAC TGAAGCAGAA GCGTCACGAG TCTGTGTTCG GCGTTAACTT GTACGTTAAG AACCTGGACG ACACAATCGA TGACGATCGT CTGCGCATCG CGTTCTCTCC ATACGGCAAC ATCACATCGG CCAAGGTCAT GACCGATGAG GAGGGTCGCT CCAAGGGATT CGGCTTCGTG TGCTTCAATG CCGC