DETAILED VIEW
VDRC ID 21000
Library GD Stocks (GD)
Construct ID 9897
CG Number (r6.01) CG5978
FlyBase gene number FBgn0035916
FBgn0046265
Synonyms BEST:LD24460
dGAPsec
GAPsec
GTPase activating protein, SECIS-dependent read-through
Hairpin Length 318
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGCCTCCGATCCTGACCTCACA
Right Primer GCGTCTAGAAAATCGCTGTTCGTCCGCAAA
Template genomic
Sequence GCCTCCGATC CTGACCTCAC ATATCGCGCC CACGCTGAGG CTGATTGTTT CTTTTGTTTT ACCGCCCTGA TGAGCGAGAT AAGAGACTTT TTTATTAAAA CACTAGACGA CGCAGAAGGC GGCATCAAGT TCATGATGGC CAGGCTATCG AATATGCTGA AATCAAAGGA CCTAAGCATT TACGAGCTAC TCAGGAGCCA AGAGCTGCAT CCGCAGTATT ACAGCTTCAG GTGGCTCACA CTGCTCCTGT CGCAGGAGTT TCCACTGCCA GATGTACTGC GCATTTGGGA TTCCGTGTTT GCGGACGAAC AGCGATTT