DETAILED VIEW
VDRC ID 19173
Library GD Stocks (GD)
Construct ID 8795
CG Number (r6.01) CG17332
FlyBase gene number FBgn0027779
Synonyms 144191_at
ATP6V1H
V1 H subunit
Vacuolar H[+]-ATPase SFD subunit
Vacuolar H+-ATPase SFD subunit
V-ATPase
V-ATPase H-subunit
V-ATPase subunit H
vhaSFD
VhaSFD
Hairpin Length 309
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 1
Left Primer CGCGGATCCCACGCATTATCCTCGCGGTCTT
Right Primer GCGTCTAGACGTTTAGGCGCTGGGCATTCT
Template genomic
Sequence CACGCATTAT CCTCGCGGTC TTCCGCAATC TGATCGAGAA GCCGGAGGAT TCATCGGTGG CCAAGGACCA TTGCATCGCC ATGGTCCAGT GCAAGGTGCT GAAGCAGCTA TCCATCCTGG AGCAGCGTCG CTTCGACGAC GAGGACATTA CCGCCGACGT AGAGTACCTG AGCGAGAAGC TCCAGAATTC GGTGCAAGAC TTGAGCTCCT TTGATGAGTA CGCCACAGAG GTGCGCAGCG GTCGCTTGGA ATGGTCGCCT GTGCACAAGT CGGCCAAGTT CTGGCGCGAG AATGCCCAGC GCCTAAACG