DETAILED VIEW
VDRC ID 16893
Library GD Stocks (GD)
Construct ID 1554
CG Number (r6.01) CG4380
FlyBase gene number FBgn0003964
Synonyms 2C
cf1
Cf1
CF1
CF1/Usp
CF1/USP
Chorion factor 1
chorion factor CF1
dmUSP
DmUsp
DmUSP
dUSP
EG:22E5.1
l(1)2Cf
l(1)usp
NR2B4
ultraspiracle
Ultraspiracle
Ultraspiricle
usp
Usp
USP
XR2C
X receptor at 2C
Hairpin Length 289
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 5
Viability lethal
Inserted Chromosome 3
Left Primer CGCGAATTCGCCACATCAAGGAGGAGGTCAAG
Right Primer CGCTCTAGAGTCCCCGCAAATAGAGCAGAGGT
Template genomic
Sequence GCCACATCAA GGAGGAGGTC AAGCCGGACA TCTCGCAGCT GAACGACAGC AACAACAGCA GCTTTTCGCC CAAGGCCGAG AGTCCCGTGC CCTTCATGCA GGCCATGTCC ATGGTCCACG TGCTGCCCGG CTCCAACTCC GCCAGCTCCA ACAACAACAG CGCTGGAGAT GCCCAAATGG CGCAGGCGCC CAATTCGGCT GGAGGCTCTG CCGCCGCTGC AGTCCAGCAG CAGTATCCGC CTAACCATCC GCTGAGCGGC AGCAAGCACC TCTGCTCTAT TTGCGGGGA