DETAILED VIEW
VDRC ID 16678
Library GD Stocks (GD)
Construct ID 5660
CG Number (r6.01) CG6378
FlyBase gene number FBgn0026562
FBgn0027691
Synonyms anon-EST:Posey291
BM40
BM-40 Sparc
BM-40-SPARC
BM-40/SPARC
CT19876
dsparc
dSPARC
Osteonectin
sparc
Sparc
SPARC
Hairpin Length 345
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCTGCACGACGAGAAGCCCAAA
Right Primer CGCTCTAGAGTCTCCGCCTCCAGCTCCATC
Template genomic
Sequence TGCACGACGA GAAGCCCAAA TGCGTGTGCA TTCCGGAGTG CCCGGAGGAG GTGGACACTC GCCGCCTGGT CTGCACCAAT ACCAACGAGA CCTGGCCGTC GGACTGCTCT GTGTATCAGC AGCGCTGCTG GTGCGACAGC GGCGAGCCCG GCTGCACCAA TCCGGACAAC GCGCACATGC ACATCGACTA CTACGGCGCT TGCCACGAGC CCAGGAGCTG CGAGGGCGAG GACCTGAAGG ACTTCCCCAG GCGCATGCGC GACTGGCTGT TCAACGTGAT GCGCGACCTG GCCGAGCGCG ACGAGCTGAC CGAGCACTAC ATGCAGATGG AGCTGGAGGC GGAGA