DETAILED VIEW
VDRC ID 16133
Library GD Stocks (GD)
Construct ID 7149
CG Number (r6.01) CG10967
FlyBase gene number FBgn0036313
FBgn0010715
FBgn0062118
FBgn0044321
FBgn0064136
FBgn0260945
Synonyms anon-WO0118547.287
atg1
Atg1
ATG1
autophagy-related gene 1
autophagy-specific gene1
Autophagy-specific gene 1
dAtg1
dATG1
DK-4
DmATG1
l(3)00305
Pegarn
ULK1
unc51
unc-51
Unc51
Unc-51
UNC 51-like
uncoordinated movement-51
Hairpin Length 320
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCTGCCCATCTCTGAACCCAAACC
Right Primer GCGTCTAGAAACGGCGATTGCGAGTGTCC
Template genomic
Sequence CTGCCCATCT CTGAACCCAA ACCAGTACCG GCTCCCGCTC GGCGGCAGGT GGCCAGGCCC GGGCCGTTAA CGGTAGCCAC ACTGGGTGGC CAGCAGATAC CCCGATCGCA GCCAATTAGC GTAAAGCAAC CGCGACCGGA TCAGCGCAAG AGCAGTGTGA GCAGTGACAT TAACTCGATC TCACCGCCGG CGGTGCAGTT TGCCATTGGA ACGCCGCCTA CACGTATGCG TTCTGCCTCT GGTGGATCGC TGTCGGAGAC ACCGCCGCCG CATGCACCGA GCACCTGGCA GGTGTCGCCA GGACACTCGC AATCGCCGTT