DETAILED VIEW
VDRC ID 15305
Library GD Stocks (GD)
Construct ID 4710
CG Number (r6.01) CG11051
FlyBase gene number FBgn0062965
FBgn0040813
Synonyms BcDNA:RH08410
NEF
NEF peptide
neuropeptide-like precursor 2
Neuropeptide-like precursor 2
nplp2
Nplp2
NPLP2
NPLP 2
Hairpin Length 251
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGGATCCGGCCAAGCTCGCAATTTGCAT
Right Primer GCGTCTAGAATGCGGCTGGTGCCTGAAGA
Template cDNA
Sequence GGCCAAGCTC GCAATTTGCA TCCTCGTGTT CGCCCTGTTC GCCTTGGCTC TGTCCGCCCG CGTCCCCCGT GAGGAATCCA ATCCTGCCCA AGAATTTCTT ACCAAGGCCC AGGGTGATTT CAACGAATTC ATTGAAAAGT TGAAGGCGTT GGACGCGAAG AAGGTTGAGG GTCTCTTCAA GGATGGATTA AATACCGTGC AGGAGGGTCT GCAAAAACTT AACGAAACAT TTCTTCAGGC ACCAGCCGCA T