Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 11470
Library GD Stocks (GD)
Construct ID 732
CG Number (r6.01) CG33517
FlyBase gene number FBgn0031083
FBgn0053517
FBgn0046600
FBgn0046542
FBgn0031084
FBgn0046543
FBgn0046601
FBgn0062410
Synonyms anon-WO0170980.130
anon-WO0170980.131
anon-WO0170980.31
anon-WO0170980.32
CG17004
CG9569
D[[2]]-like receptor
D2-like receptor
D2R
D[[2]] receptor
dD2R
DD2R
Dop2R
dopamine 2-like receptor
Dopamine 2-like receptor
Dopamine 2-like Receptor
dopamine D2 receptor
Hairpin Length 271
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 3
Viability sterile
Inserted Chromosome 3
Left Primer CGCGAATTCTGAGGAGTCGAGCGCGGAAG
Right Primer CGCTCTAGAGCCAGCATGAACTCGGTGGA
Template genomic
Sequence TGAGGAGTCG AGCGCGGAAG CAGCGGGCGG CCCGCAAGCC CCACCTATCG GAACTCACGG GCGGCAGCGT CATCGAGAAC ATTGCCCAGA CCCGGCGCCT GGCGGAGACG GCCCTGGACA GCAGTCGCCA CGCCAGTAGG ATTCTGCCCG ACGAGGCCGC CACCAACACG GCCAGCGGCT CCAACGAGGA GGAGGACGAG AACGCCATCT CGCCGGACAT CGACGACTGC CACGTCATCG TGAACGACAA GTCCACCGAG TTCATGCTGG C