Library Name/Genotype
Category Status
313196 JB-STOCK w; ; pGLKD>cuff_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG13190
Gene: cutoff
Link Julius Brennecke IMBA RNAi lines available
313612 JB-STOCK w; piRinternalA-biogenesis-reporter #14 [attp40]/CyO; pV22>zuc_sh [attP2]/TM3, Ser; based on stocks DH14 and Bloomington stock 35227 Julius Brennecke IMBA piRinternalA biogenesis reporter available
313172 JB-STOCK w; ; pGLKD>papi_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG7082
Gene: papi
Link Julius Brennecke IMBA RNAi lines available
313656 JB-STOCK w; ; zuc_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-41M17 containing the zuc locus with C-terminal GFP_Precission_V...
CG Number: CG12314
Gene: zucchini
Julius Brennecke IMBA tagged construct available
313614 JB-STOCK w; piRinternalA-biogenesis-reporter #16 [attp40]/CyO; pV22>zuc_sh [attP2]/TM3, Ser; based on stocks DH16 and Bloomington stock 35227 Julius Brennecke IMBA piRinternalA biogenesis reporter available
313983 JB-STOCK ; FLAG_V5_GFP_Panx m13-1; ; Guide: ACTTTGACCTCTAGCTTCAT, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP...
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA tagged endogenous genes available
313392 JB-STOCK ; pUASp>lambdaN-HA-Piwi [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering Piwi to 3'UTR of GFP-reporter ...
CG Number: CG6122
Gene: Piwi
Julius Brennecke IMBA tethering lines available
313521 JB-STOCK w; ; pGLKD>white_sh [attP2]/TM3, Sb ; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo se...
CG Number: CG2759
Gene: white
Link Julius Brennecke IMBA RNAi lines available
313279 JB-STOCK w; 3xFLAG/GFP_Gtsf1 [attP40]/CyO; ; BAC-construct containing the Gtsf1 locus with N-terminal 3xFLAG-GFP tag; pl...
CG Number: CG3893
Gene: Gtsf1
Julius Brennecke IMBA Tagged construct available
313717 JB-STOCK w; ; Nxt1_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-123E19 containing the Nxt1 locus with C-terminal GFP_Precission...
CG Number: CG12752
Gene: NTF2-related export protein 2
Julius Brennecke IMBA tagged construct available
313985 JB-STOCK ; ; FLAG_V5_GFP_Nxf2 m12-1; Guide: CAAAGTCCAGCACTCTCATC, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP...
CG Number: CG4118
Gene: Nxf2
Julius Brennecke IMBA tagged endogenous genes available
313212 JB-STOCK ; ; nos>NLS_GFP_lacZ_vas-3'UTR_burdock-target [attP2]/TM3, Sb; Burdock GFP-lacZ sensor driven by nanospromoter and carrying a vasa 3'UTR; u...
Gene: burdock
Link Julius Brennecke IMBA reporter available
313594 JB-STOCK w[1118];; aub [g2]/CyO; ago3 [g1]/TM6B, Tb, Hu; based on stocks KS27and KS28
CG Number: CG6137, CG40300
Gene: aubergine/Argonaute 3
Link Julius Brennecke IMBA mutant alleles available
313749 JB-STOCK w1118[TM3]; ; w1118.iso1.1 crossed twice to Ly/TM3, Sb and stocks made by removing balance...
CG Number: CG2759
Gene: w
Julius Brennecke IMBA mutant allele available
313411 JB-STOCK COG-Gal4; NGT-Gal4/CyO; nosGal4, GFP_Gtsf1/TM3,Ser; MTD-Gal4 line that also expresses GFP-Gtsf1 from BAC-construct
CG Number: CG3893
Gene: Gtsf1
Julius Brennecke IMBA Tagged construct available
313999 JB-STOCK w; ;Nxf3[D434R]_GFP_Precission-V5-3FLAG/TM3,Sb; Nxf3 locus (C-terminally tagged with GFP) with the D434R mutation; Guide: ct...
CG Number: CG32135
Gene: nuclear RNA export factor 3
Julius Brennecke IMBA tagged endogenous genes available
313400 JB-STOCK ; pUASp>LacI_CG9754 [attP40]/CyO; lacO_nos>GFP_Piwi (with intron) [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering CG9754 to upstream of nanos pr...
CG Number: CG9754
Gene: CG9754
Julius Brennecke IMBA tethering lines available
313667 JB-STOCK Cog-GAL4; internalGT-GAL4/CyO; nos-GAL4, rhi-GFP/TM3,Ser;
CG Number: CG10683
Gene: rhi
Julius Brennecke IMBA GAL4 driver available
313583 JB-STOCK w; pGLKD>aub_sh1 [attP40]; pV22>ago3_sh [attP2]; based on TRiP GL00117 and aub_sh construct (plasmid JB144; pGLKD vector from...
CG Number: CG6137, CG40300
Gene: aubergine/argonaute 3
Link Julius Brennecke IMBA RNAi lines available
313161 JB-STOCK w; ; pGLKD>krimp_sh2[attP2]/TM3; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG15707
Gene: krimper
Link Julius Brennecke IMBA RNAi lines temporarily unavailable
313157 JB-STOCK w; ; pGLKD>rhino_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG10683
Gene: rhino
Link Julius Brennecke IMBA RNAi lines available
314018 JB-STOCK w; Panx-dCtp/Cyo; Panx[Ctp-mut] CRISPR mutant all 5 to A
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA mutant allele available
313527 JB-STOCK w[1118]; piwi [g1]/CyO; iso3; piwi Cas9 allele (guide RNA1; KS3-1m1-1); generated in the w[1118] stock wit...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA mutant alleles available
313198 JB-STOCK w; ; pGLKD>SoYb_sh1(attP40)/CyO; ; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG31755
Gene: Sister of Yb
Link Julius Brennecke IMBA RNAi lines temporarily unavailable
313181 JB-STOCK w; ; pW20>RNPS1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtACCCCAGTTCAATAGGTTCAAta...
CG Number: CG16788
Gene: RNA-binding protein S1
Link Julius Brennecke IMBA RNAi lines available
313155 JB-STOCK w; ; pGLKD>mael_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA RNAi lines available
314047 JB-STOCK ; pUASp>lambdaN-HA-Panx [attP40] tub>EGFP_5xBoxB_SV40 [attP33]/CyO;
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA BoxB silencing reporter available
314006 JB-STOCK w; pNASA>Nxf3_GFP[attP40]/CyO; nxf3[A2-2]/TM3, Ser; Nxf3 wildtype rescue construct expressed by the NASA vector in the nxf3 muta...
CG Number: CG32135
Gene: nuclear RNA export factor 3
Julius Brennecke IMBA Tagged construct available
313684 JB-STOCK ; ; Nxf2_MB1-4/TM3, Sb; pan5b-m1-4; indel: -1; seq: ATAAGGGCCGCCTGGAATAC-cggaatATCCGGAGCAGATAATCCTGG...
CG Number: CG4118
Gene: Nxf2
Julius Brennecke IMBA mutant allele available
313994 JB-STOCK w,sbr[m9-8]/FM7c; ; ; frameshift allele; pan14-m-9-8; indel: -4; seq: TAAAGAAGATTACGCAGTTTCGCTCCAC...
CG Number: CG1664
Gene: small bristles
Julius Brennecke IMBA mutant allele available
313738 JB-STOCK w, moon_FS2∆28/FM7c; ; pan2b-m8-1; indel: -28; seq: CATCACATCC----------------------------AGATGCCAT...
CG Number: CG12721
Gene: moon
Julius Brennecke IMBA mutant allele available
313513 JB-STOCK w; piwi[1], Bac(GFP-Piwi[deltaNLS] #1) attP40/CyO; ; piwi[1] allele with genomic rescue construct in attP40 expressing GFP-Piwi w...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA tagged construct available
313327 JB-STOCK w; BAC{GFP-piwi[cDNA+intron4_pY-fixed-int7]_R12} [attP40]/CyO; ; based on construct from stock 344 (plasmid JB93); only intron 4 retained and...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313207 JB-STOCK ; ; tub>EGFP (miRNA control sensor); tub driven EGFP; published in Brennecke et al. 2003
Gene: GFP
Link Julius Brennecke IMBA miRNA sensor available
314034 JB-STOCK w; matalpha-GAL4-VP16, osk-GAL4-VP16/CyO; bam-GAL4/TM3, Ser Julius Brennecke IMBA GAL4 driver available
313607 JB-STOCK w; piRinternalA-biogenesis-reporter #18 [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRinternalA biogenesis reporter available
313487 JB-STOCK w; rhi[18-5]/CyO; ; rhi knock-out generated via classical homologous recombination of entire Rhi...
CG Number: CG10683
Gene: rhino
Link Julius Brennecke IMBA mutant allele available
313672 JB-STOCK Cog-GAL4; internalGT-GAL4/CyO; nos-GAL4, del-GFP/TM3,Ser;
CG Number: CG9252
Gene: del
Julius Brennecke IMBA GAL4 driver available
313223 JB-STOCK UAS Dcr-2(X),hs-hid(Y); NGT-Gal4-VP16; nos>GFP_lacZ_HetA/Ser; germline HeT-A sensor; based on stock 537; published in Donertas et al. (201...
Gene: HeT-A
Link Julius Brennecke IMBA reporter available
313134 JB-STOCK w; ; pW20>CG3689_sh2[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtACCAACGATAGCGCTACCTAAta...
CG Number: CG3689
Gene: CG3689
Link Julius Brennecke IMBA RNAi lines available
313201 JB-STOCK w; If/CyO; pGLKD>tud_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG9450
Gene: tudor
Link Julius Brennecke IMBA RNAi lines available
313205 JB-STOCK w; If/CyO; pGLKD>spoon_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG3249
Gene: Spoonbill
Link Julius Brennecke IMBA RNAi lines available
313910 JB-STOCK ;panx[g2];N1_Panx; panx allele described in Sienski et al. (2015); third chromosome carries Pac...
CG Number: CG9754
Gene: Panoramix
Julius Brennecke IMBA Tagged construct available
313186 JB-STOCK ; If/CyO; pGLKD>CG9925_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG9925
Gene: CG9925
Link Julius Brennecke IMBA RNAi lines temporarily unavailable
313471 JB-STOCK w; piRNA-biogenesis-reporter #28 [attP40]/CyO; pGLKD>white_sh(10U) [attP2]/TM3,Ser; Gblock cloned into pJB634 (trigger sensor plasmid version 2 from Dominik Han... Julius Brennecke IMBA piRNA biogenesis reporter available
313271 JB-STOCK w; ; 3xFLAG/V5/Precission/GFP_Del [attP2]/TM3,Sb; Pacman CH322-104C22 containing the Del locus with N-terminal 3xFLAG_V5_Preci...
CG Number: CG9252
Gene: Deadlock
Julius Brennecke IMBA Tagged construct available
314043 JB-STOCK Cog-GAL4; NGT-GAL4/If; nos-GAL4,/3xFLAG_V5_Precission_GFP-THO2/TM3,Ser;
CG Number: CG31671
Gene: Tho2
Julius Brennecke IMBA MTD;GFP reporter available
313408 JB-STOCK ; If/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser; GFP sensor for RNA tethering; GFP expressed under ubiquitous tubulin promote... Link Julius Brennecke IMBA tethering lines available
313586 JB-STOCK w; nanos>GFP-Piwi_vasa3'UTR [attP40]/CyO; pV22>ago3_sh [attP2]/TM3, Ser; based on stocks KS4 (TRiP GL00117) and KS6
CG Number: CG40300
Gene: Argonaute 3
Link Julius Brennecke IMBA RNAi lines available
313199 JB-STOCK w; ; pGLKD>piwi_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG6122
Gene: piwi
Julius Brennecke IMBA RNAi lines temporarily unavailable
313705 JB-STOCK w; papi[1-5-2]; ; papi null allele (frameshift induced by Cas9); sequence: GACATTAGCGGCGTTCCCG...
CG Number: cg7082
Gene: papi
Julius Brennecke IMBA CRISPR line available
313711 JB-STOCK w; TR58/CyO; Sb/TM3, Ser; attP40 landing site, trigger sensor construct TR58, GBlock: GGACGAGCTGTACAAG... Julius Brennecke IMBA sensor line available
313316 JB-STOCK w; ; papi_GFP/Precission/V5/3xFLAG [attP2]/TM3,Sb; Pacman CH322-41G09 containing the papi locus with C-terminal GFP_Precission_...
CG Number: CG7082
Gene: papi
Link Julius Brennecke IMBA Tagged construct available
313723 JB-STOCK UAS Dcr-2(X),hs-hid(Y); NGT-Gal4-VP16; nos-GAL4, nos>GFP_lacZ_HeT-A_700/Ser; germline HeT-A sensor; based on stock 537; target sequence shorter than the ...
Gene: HeT-A
Julius Brennecke IMBA reporter available
313514 JB-STOCK w; piwi[1], Bac(GFP-Piwi[deltaNLS] #2) attP40/CyO; ; piwi[1] allele with genomic rescue construct in attP40 expressing GFP-Piwi w...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA tagged construct available
313714 JB-STOCK Cog-GAL4; NGT-GAL4; nos-GAL4, Zuc_GFP_Precission_V5_3xFLAG[attP2]/TM3, Ser;
CG Number: cg12314
Gene: zucchini
Julius Brennecke IMBA Pacman recombineering temporarily unavailable
313495 JB-STOCK w; piRNA-biogenesis-reporter #3 [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Link Julius Brennecke IMBA piRNA biogenesis reporter available
313163 JB-STOCK w; ; pW20>krimp_sh2[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCAGATTGGGAGACTACGAATAta...
CG Number: CG15707
Gene: krimper
Link Julius Brennecke IMBA RNAi lines available
314046 JB-STOCK Cog-GAL4; NGT-GAL4; Sb/TM3,Ser; entry strain Julius Brennecke IMBA Gal4 driver available
313333 JB-STOCK w; BAC{GFP-piwi[cDNA+intron4+int5@504bp_down]_R21} [attP40]/CyO; ; based on construct from stock 344 (plasmid JB93); only intron 4 retained; in...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313298 JB-STOCK w; 3xFLAG/GFP_mael [attP40]/CyO; ; BAC construct containing the maelstrom locus with N-terminal 3xFLAG-GFP tag;...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA Tagged construct available
313185 JB-STOCK w; ; pW20>sbr_sh1/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtAAGCGATGCTCTCCATATCAAta...
CG Number: CG1664
Gene: small bristles
Link Julius Brennecke IMBA RNAi lines available
313144 JB-STOCK w; ; pGLKD>egg_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG12196
Gene: eggless
Link Julius Brennecke IMBA RNAi lines available
314033 JB-STOCK w; matalpha-GAL4-VP16, osk-GAL4-VP16/CyO; Based on BDSC stocks 7062 and 44241 Julius Brennecke IMBA GAL4 driver available
313874 JB-STOCK Cog-GAL4; internalGT-GAL4/CyO; nos-GAL4, zuc-GFP/TM3,Ser;
CG Number: CG12314
Gene: zucchini
Julius Brennecke IMBA tagged construct available
313089 JB-STOCK ; FLAG_GFP_mael-mut[H291A][attP40]/CyO; ; Pacman clone; expresses indicated Maelstrom protein from endogenous regulato...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA tagged construct available
313462 JB-STOCK w; piRNA-biogenesis-reporter #22 [attP40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRNA biogenesis reporter available
313873 JB-STOCK MTD, GFP::Nibbler Nibbler-N1 Pacman in attP2
CG Number: CG9247
Gene: nibbler
Julius Brennecke IMBA tagged construct temporarily unavailable
313150 JB-STOCK w; ; pW20>Gtsf1_sh[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: CTAGCAGTAGCACAGGAGGCCATACTCAATA...
CG Number: CG3893
Gene: Gtsf1
Julius Brennecke IMBA RNAi lines available
313468 JB-STOCK w; piRNA-biogenesis-reporter #2 [attP40]/CyO; Sb/TM3,Ser; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRNA biogenesis reporter available
314044 JB-STOCK Cog-GAL4; NGT-GAL4; nos-GAL4, Nxf3_GFP_Precission_V5_3xFLAG[attP2]/TM3, Ser;
CG Number: CG32135
Gene: nxf3
Julius Brennecke IMBA MTD;GFP reporter available
313735 JB-STOCK w, moon_FS1∆1/FM7c; ; pan2a-m3-3; indel: -1; seq: CGACTCCGGTATCCAGA-GCCATCGGTGGGCAATATCTTGGCCATGGC...
CG Number: CG12721
Gene: moon
Julius Brennecke IMBA mutant allele available
313269 JB-STOCK w; ; 3xFLAG/V5/Precission/GFP_Cuff [attP2]/TM3,Sb; Pacman CH322-174E18 containing the Cuff locus with N-terminal 3xFLAG_V5–Prec...
CG Number: CG13190
Gene: Cutoff
Julius Brennecke IMBA Tagged construct available
313394 JB-STOCK ; If/CyO; lacO_nos>GFP-Piwi (with intron) [attP2]/TM3, Ser; nanos-promoter driven GFP-Piwi (including piwi introns); robust expression i... Julius Brennecke IMBA tethering lines available
313682 JB-STOCK ; ; Nxf2_MA4-6/TM3, Sb; pan5a-m4-6; indel: -17; seq: CGGCGATCGTGTTCCGGGTACCC--------------g---GTGCAC...
CG Number: CG4118
Gene: Nxf2
Julius Brennecke IMBA mutant allele available
313715 JB-STOCK w; Papi_GFP_Precission_V5_3xFLAG[attP40]/CyO; Sb/TM3, Ser; Pacman CH322-41G09 containing the papi locus with C-terminal GFP_Precission_...
CG Number: cg7082
Gene: papi
Julius Brennecke IMBA Pacman recombineering available
313771 JB-STOCK ; ; P{TRiP.GL01076}attP2; Crossed twice to Ly/TM3,Sb - used for CG12721 analyses!
CG Number: CG18009
Gene: Trf2
Julius Brennecke IMBA RNAi line available
313585 JB-STOCK w; nanos>GFP-Piwi_vasa3'UTR [attP40]/CyO; pGLKD>aub_sh1 [attP2]/TM3, Ser; based on stocks 402 and KS6
CG Number: CG6137
Gene: aubergine
Link Julius Brennecke IMBA RNAi lines available
314045 JB-STOCK Cog-GAL4; NGT-GAL4/CyO; nos-GAL4, 3xFLAG_V5_Precission_GFP-Hel25E/TM3,Ser;
CG Number: CG7269
Gene: Hel25E
Julius Brennecke IMBA MTD;GFP reporter available
314022 JB-STOCK w;FLAG-GFP-Panx[delta-Ctp]/Cyo; ; panx mutant flies (Stock #313500) containing Panx[delta-Ctp] coding sequence...
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA rescue construct available
313124 JB-STOCK w; ; pW20>Actr13E_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtGCGACGCGAAGTCACAGTTGAta...
CG Number: CG11678
Gene: actin relatet protein 13E
Link Julius Brennecke IMBA RNAi lines available
313982 JB-STOCK ; FLAG_V5_GFP_Panx m8-1; ; Guide: ACTTTGACCTCTAGCTTCAT, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP...
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA tagged endogenous genes available
313137 JB-STOCK w; ; pW20>CG40228_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCACCTCCGAAGAGAAAGAATAta...
CG Number: CG40228
Gene: CG40228
Link Julius Brennecke IMBA RNAi lines available
313780 JB-STOCK MTD; MTD/CyO; MTD, LAP-moon[attP2];
CG Number: CG12721
Gene: moon
Julius Brennecke IMBA Tagged construct available
313126 JB-STOCK w; ; pW20>asf1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCCGCGTGGGCTACTATGTGAAta...
CG Number: CG9383
Gene: anti-silencing factor 1
Link Julius Brennecke IMBA RNAi lines available
313133 JB-STOCK w; ; pW20>Gasz_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCCCCAGATTCCGACTCTGATAta...
CG Number: CG2183
Gene: Gasz
Link Julius Brennecke IMBA RNAi lines available
313175 JB-STOCK w; ; pGLKD>BoYb_sh2(attP2)/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG11133
Gene: Brother of Yb
Link Julius Brennecke IMBA RNAi lines available
313399 JB-STOCK ; pUASp>LacI_Piwi [attP40]/CyO; lacO_nos>GFP-Piwi (with intron) [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering Piwi to upstream of nanos prom...
CG Number: CG6122
Gene: Piwi
Julius Brennecke IMBA tethering lines available
CG Number: CG12110
Gene: Pld
Julius Brennecke IMBA mutant allele available
313589 JB-STOCK w; GFP-Nup107/CyO; pGLKD>piwi_sh2 [attP2]/TM3, Ser; based on stocks KS12 and 401
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA RNAi lines available
CG Number: NA
Gene: cluster38C1
Julius Brennecke IMBA mutant allele available
313115 JB-STOCK w; If/CyO; vreteno[delta1]/TM3,Ser; created by imprecise P-Element excision (using Bloomington stock #22204)
CG Number: CG4771
Gene: vreteno
Link Julius Brennecke IMBA mutant alleles temporarily unavailable
313203 JB-STOCK w; ; pW20>vret_sh4[attP2]/TM3, Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCAGCTGGAAAGACTGTATGAAta...
CG Number: CG4771
Gene: vreteno
Link Julius Brennecke IMBA RNAi lines available
313713 JB-STOCK w; If/CyO; 3xFLAG_V5_Precission_GFP_Nbr[attP2]/TM3, Ser; Pacman CH322-18I04 containing the Nbr locus with N-terminal 3xFLAG_V5_Precis...
CG Number: cg9247
Gene: nibbler
Julius Brennecke IMBA Pacman recombineering available
313132 JB-STOCK w; ; pW20>Gasz_sh2[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtTCCCTTGTTCATTGACTTCAAta...
CG Number: CG2183
Gene: Gasz
Link Julius Brennecke IMBA RNAi lines available
CG Number: NA
Gene: cluster42AB
Julius Brennecke IMBA mutant allele available
313024 JB-STOCK ; ;armi[Df},FRT80B/ TM3, Sb; Deletion FDD-0152622 from e01160 and d07385 (VDRC#313015)
CG Number: CG11513
Gene: armitage
Julius Brennecke IMBA Deficiencies available
313469 JB-STOCK w;piRNA-biogenesis-reporter #4 [attP40]/CyO; pGLKD>white_sh [attP2]/TM3,Ser; Gblock cloned into plasmid JB (trigger sensor plasmid version 2 from Dominik... Julius Brennecke IMBA piRNA biogenesis reporter available
313123 JB-STOCK w; ; pW20>Acn_sh1/[attP2]TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtACCGCCTATCAGACTACTAGAta...
CG Number: CG10473
Gene: Acinus
Link Julius Brennecke IMBA RNAi lines available
313167 JB-STOCK w; ; pW20>Nxt1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCTCCGTCAAGTTCGCAGATCAta...
CG Number: CG12752
Gene: NTF2-related export protein 1
Link Julius Brennecke IMBA RNAi lines available

NEW - recently added to our collection

SIMILAR – further resources related to your item of interest, eg. for the same gene.