Library Name/Genotype
Category Status
313196 JB-STOCK w; ; pGLKD>cuff_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG13190
Gene: cutoff
Link Julius Brennecke IMBA RNAi lines available
313612 JB-STOCK w; piRinternalA-biogenesis-reporter #14 [attp40]/CyO; pV22>zuc_sh [attP2]/TM3, Ser; based on stocks DH14 and Bloomington stock 35227 Julius Brennecke IMBA piRinternalA biogenesis reporter available
313656 JB-STOCK w; ; zuc_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-41M17 containing the zuc locus with C-terminal GFP_Precission_V...
CG Number: CG12314
Gene: zucchini
Julius Brennecke IMBA tagged construct available
313172 JB-STOCK w; ; pGLKD>papi_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG7082
Gene: papi
Link Julius Brennecke IMBA RNAi lines available
313614 JB-STOCK w; piRinternalA-biogenesis-reporter #16 [attp40]/CyO; pV22>zuc_sh [attP2]/TM3, Ser; based on stocks DH16 and Bloomington stock 35227 Julius Brennecke IMBA piRinternalA biogenesis reporter available
313983 JB-STOCK ; FLAG_V5_GFP_Panx m13-1; ; Guide: ACTTTGACCTCTAGCTTCAT, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP...
CG Number: CG9754
Gene: Panx
Julius Brennecke IMBA tagged endogenous genes available
313392 JB-STOCK ; pUASp>lambdaN-HA-Piwi [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering Piwi to 3'UTR of GFP-reporter ...
CG Number: CG6122
Gene: Piwi
Julius Brennecke IMBA tethering lines available
313521 JB-STOCK w; ; pGLKD>white_sh [attP2]/TM3, Sb ; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo se...
CG Number: CG2759
Gene: white
Link Julius Brennecke IMBA RNAi lines available
313279 JB-STOCK w; 3xFLAG/GFP_Gtsf1 [attP40]/CyO; ; BAC-construct containing the Gtsf1 locus with N-terminal 3xFLAG-GFP tag; pl...
CG Number: CG3893
Gene: Gtsf1
Julius Brennecke IMBA Tagged construct available
313717 JB-STOCK w; ; Nxt1_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-123E19 containing the Nxt1 locus with C-terminal GFP_Precission...
CG Number: CG12752
Gene: NTF2-related export protein 2
Julius Brennecke IMBA tagged construct available
313985 JB-STOCK ; ; FLAG_V5_GFP_Nxf2 m12-1; Guide: CAAAGTCCAGCACTCTCATC, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP...
CG Number: CG4118
Gene: Nxf2
Julius Brennecke IMBA tagged endogenous genes available
313212 JB-STOCK ; ; nos>NLS_GFP_lacZ_vas-3'UTR_burdock-target [attP2]/TM3, Sb; Burdock GFP-lacZ sensor driven by nanospromoter and carrying a vasa 3'UTR; u...
Gene: burdock
Link Julius Brennecke IMBA reporter available
313594 JB-STOCK w[1118];; aub [g2]/CyO; ago3 [g1]/TM6B, Tb, Hu; based on stocks KS27and KS28
CG Number: CG6137, CG40300
Gene: aubergine/Argonaute 3
Link Julius Brennecke IMBA mutant alleles available
313749 JB-STOCK w1118[TM3]; ; w1118.iso1.1 crossed twice to Ly/TM3, Sb and stocks made by removing balance...
CG Number: CG2759
Gene: w
Julius Brennecke IMBA mutant allele available
313999 JB-STOCK w; ;Nxf3[D434R]_GFP_Precission-V5-3FLAG/TM3,Sb; Nxf3 locus (C-terminally tagged with GFP) with the D434R mutation; Guide: ct...
CG Number: CG32135
Gene: nuclear RNA export factor 3
Julius Brennecke IMBA tagged endogenous genes available
313400 JB-STOCK ; pUASp>LacI_CG9754 [attP40]/CyO; lacO_nos>GFP_Piwi (with intron) [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering CG9754 to upstream of nanos pr...
CG Number: CG9754
Gene: CG9754
Julius Brennecke IMBA tethering lines available
313667 JB-STOCK Cog-GAL4; internalGT-GAL4/CyO; nos-GAL4, rhi-GFP/TM3,Ser;
CG Number: CG10683
Gene: rhi
Julius Brennecke IMBA GAL4 driver available
313583 JB-STOCK w; pGLKD>aub_sh1 [attP40]; pV22>ago3_sh [attP2]; based on TRiP GL00117 and aub_sh construct (plasmid JB144; pGLKD vector from...
CG Number: CG6137, CG40300
Gene: aubergine/argonaute 3
Link Julius Brennecke IMBA RNAi lines available
313157 JB-STOCK w; ; pGLKD>rhino_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG10683
Gene: rhino
Link Julius Brennecke IMBA RNAi lines available
313161 JB-STOCK w; ; pGLKD>krimp_sh2[attP2]/TM3; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG15707
Gene: krimper
Link Julius Brennecke IMBA RNAi lines available
313527 JB-STOCK w[1118]; piwi [g1]/CyO; iso3; piwi Cas9 allele (guide RNA1; KS3-1m1-1); generated in the w[1118] stock wit...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA mutant alleles available
313198 JB-STOCK w; ; pGLKD>SoYb_sh1(attP40)/CyO; ; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG31755
Gene: Sister of Yb
Link Julius Brennecke IMBA RNAi lines temporarily unavailable
313768 JB-STOCK w; ; pW20 > nxf3_sh2[attP2]/TM3, Sb;
CG Number: CG32135
Gene: nxf3
Julius Brennecke IMBA RNAi line available
313151 JB-STOCK w; ; pW20>btz_sh1(attP2)/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtTGGCATGGAATTTAAGAAGAAta...
CG Number: CG17878
Gene: barentsz
Link Julius Brennecke IMBA RNAi lines available
313321 JB-STOCK w; BAC{GFP-piwi[introns]_R0} [attP40]/CyO; ; BAC-construct contining the piwi locus with N-terminal EGFP tag; plasmid JB9...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313181 JB-STOCK w; ; pW20>RNPS1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtACCCCAGTTCAATAGGTTCAAta...
CG Number: CG16788
Gene: RNA-binding protein S1
Link Julius Brennecke IMBA RNAi lines available
313722 JB-STOCK UAS Dcr-2(X),hs-hid(Y); NGT-Gal4-VP16; nos-GAL4, nos>GFP_lacZ_HeT-A_500/Ser; germline HeT-A sensor; based on stock 537;target sequence shorter than the p...
Gene: HeT-A
Julius Brennecke IMBA reporter available
313155 JB-STOCK w; ; pGLKD>mael_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA RNAi lines available
314006 JB-STOCK w; pNASA>Nxf3_GFP[attP40]/CyO; nxf3[A2-2]/TM3, Ser; Nxf3 wildtype rescue construct expressed by the NASA vector in the nxf3 muta...
CG Number: CG32135
Gene: nuclear RNA export factor 3
Julius Brennecke IMBA Tagged construct available
CG Number: NA
Gene: cluster38C1
Julius Brennecke IMBA mutant allele available
313684 JB-STOCK ; ; Nxf2_MB1-4/TM3, Sb; pan5b-m1-4; indel: -1; seq: ATAAGGGCCGCCTGGAATAC-cggaatATCCGGAGCAGATAATCCTGG...
CG Number: CG4118
Gene: Nxf2
Julius Brennecke IMBA mutant allele available
313994 JB-STOCK w,sbr[m9-8]/FM7c; ; ; frameshift allele; pan14-m-9-8; indel: -4; seq: TAAAGAAGATTACGCAGTTTCGCTCCAC...
CG Number: CG1664
Gene: small bristles
Julius Brennecke IMBA mutant allele available
314007 JB-STOCK w; pNASA>Nxf3[M533P]_GFP[attP40]; Nxf3_A2-2/TM3, Sb; Nxf3 NES mutant rescue construct expressed by the NASA vector in the nxf3 mu...
CG Number: CG32135
Gene: nuclear RNA export factor 3
Julius Brennecke IMBA Tagged construct available
313699 JB-STOCK w; nibbler[Cas9 FS allele]/CyO; ;
CG Number: cg9247
Gene: nibbler
Julius Brennecke IMBA CRISPR line available
313738 JB-STOCK w, moon_FS2∆28/FM7c; ; pan2b-m8-1; indel: -28; seq: CATCACATCC----------------------------AGATGCCAT...
CG Number: CG12721
Gene: moon
Julius Brennecke IMBA mutant allele available
313615 JB-STOCK w; piRinternalA-biogenesis-reporter #17 [attp40]/CyO; pV22>zuc_sh [attP2]/TM3, Ser; based on stocks DH17 and Bloomington stock 35227 Julius Brennecke IMBA piRinternalA biogenesis reporter available
313327 JB-STOCK w; BAC{GFP-piwi[cDNA+intron4_pY-fixed-int7]_R12} [attP40]/CyO; ; based on construct from stock 344 (plasmid JB93); only intron 4 retained and...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313160 JB-STOCK w; ; pGLKD>vas_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG43081
Gene: vasa
Link Julius Brennecke IMBA RNAi lines available
313513 JB-STOCK w; piwi[1], Bac(GFP-Piwi[deltaNLS] #1) attP40/CyO; ; piwi[1] allele with genomic rescue construct in attP40 expressing GFP-Piwi w...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA tagged construct available
313760 JB-STOCK w; ; pW20 > moon_sh3[attP2]/TM3, Sb; Crossed to MTD gives female sterility. Initially named CG12721 sh3. Sequence...
CG Number: CG12721
Gene: moon
Julius Brennecke IMBA RNAi line available
313207 JB-STOCK ; ; tub>EGFP (miRNA control sensor); tub driven EGFP; published in Brennecke et al. 2003
Gene: GFP
Link Julius Brennecke IMBA miRNA sensor available
313149 JB-STOCK w; ; pGLKD>Gtsf1_sh[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG3893
Gene: Gtsf1
Julius Brennecke IMBA RNAi lines available
313607 JB-STOCK w; piRinternalA-biogenesis-reporter #18 [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRinternalA biogenesis reporter available
313487 JB-STOCK w; rhi[18-5]/CyO; ; rhi knock-out generated via classical homologous recombination of entire Rhi...
CG Number: CG10683
Gene: rhino
Link Julius Brennecke IMBA mutant allele available
313330 JB-STOCK w; BAC{GFP-piwi[cDNA+intron3+intron4_yakuba]_R17} [attP40]/CyO; ; based on construct from stock 344 (plasmid JB93); only introns 3 and 4 retai...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313500 JB-STOCK w[1118]; CG9754[guide1_m3-4]/CyO;; CG9754 frameshift allele induced by Cas9 and guide RNA #1; strong allele, bu...
CG Number: CG9754
Gene: CG9754
Link Julius Brennecke IMBA mutant allele available
313672 JB-STOCK Cog-GAL4; internalGT-GAL4/CyO; nos-GAL4, del-GFP/TM3,Ser;
CG Number: CG9252
Gene: del
Julius Brennecke IMBA GAL4 driver available
313223 JB-STOCK UAS Dcr-2(X),hs-hid(Y); NGT-Gal4-VP16; nos>GFP_lacZ_HetA/Ser; germline HeT-A sensor; based on stock 537; published in Donertas et al. (201...
Gene: HeT-A
Link Julius Brennecke IMBA reporter available
313134 JB-STOCK w; ; pW20>CG3689_sh2[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtACCAACGATAGCGCTACCTAAta...
CG Number: CG3689
Gene: CG3689
Link Julius Brennecke IMBA RNAi lines available
313201 JB-STOCK w; If/CyO; pGLKD>tud_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG9450
Gene: tudor
Link Julius Brennecke IMBA RNAi lines available
313195 JB-STOCK w; ; pGLKD>spn-E_sh2[attP2]/TM3; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG3158
Gene: spindle-E
Link Julius Brennecke IMBA RNAi lines available
313205 JB-STOCK w; If/CyO; pGLKD>spoon_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG3249
Gene: Spoonbill
Link Julius Brennecke IMBA RNAi lines available
313595 JB-STOCK w[1118]; iso2; iso3; w[1118] stock with isogenized 2nd and 3rd chromosomes Link Julius Brennecke IMBA Crispr/Cas9 available
313591 JB-STOCK w; GFP-Nup107/CyO; pV22>ago3_sh [attP2]/TM3, Ser; based on KS12 and TRiP GL00117
CG Number: CG40300
Gene: Argonaute 3
Link Julius Brennecke IMBA RNAi lines available
313910 JB-STOCK ;panx[g2];N1_Panx; panx allele described in Sienski et al. (2015); third chromosome carries Pac...
CG Number: CG9754
Gene: Panoramix
Julius Brennecke IMBA Tagged construct available
313186 JB-STOCK ; If/CyO; pGLKD>CG9925_sh1[attP2]/TM3, Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG9925
Gene: CG9925
Link Julius Brennecke IMBA RNAi lines available
313471 JB-STOCK w; piRNA-biogenesis-reporter #28 [attP40]/CyO; pGLKD>white_sh(10U) [attP2]/TM3,Ser; Gblock cloned into pJB634 (trigger sensor plasmid version 2 from Dominik Han... Julius Brennecke IMBA piRNA biogenesis reporter available
313529 JB-STOCK w[1118]; aub [g1]/CyO; iso3; aub Cas9 allele (guide RNA1; KS2-1m3-2); generated in the w[1118] stock with...
CG Number: CG6137
Gene: aubergine
Link Julius Brennecke IMBA mutant alleles available
313530 JB-STOCK w[1118]; aub [g2]/CyO; iso3; aub Cas9 allele (guide RNA2; KS2-2m1-1); generated in the w[1118] stock with...
CG Number: CG6137
Gene: aubergine
Link Julius Brennecke IMBA mutant alleles available
313538 JB-STOCK w; piRNA-biogenesis-reporter #6 [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Link Julius Brennecke IMBA piRNA biogenesis reporter available
313386 JB-STOCK ; pUASp>lambdaN-HA-Mael [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering Mael to 3'UTR of GFP-reporter ...
CG Number: CG11254
Gene: Maelstrom
Julius Brennecke IMBA tethering lines available
313271 JB-STOCK w; ; 3xFLAG/V5/Precission/GFP_Del [attP2]/TM3,Sb; Pacman CH322-104C22 containing the Del locus with N-terminal 3xFLAG_V5_Preci...
CG Number: CG9252
Gene: Deadlock
Julius Brennecke IMBA Tagged construct available
313294 JB-STOCK w; ; 3xFLAG/GFP_mael [attP2]/TM3, Sb; BAC construct containing the maelstrom locus with N-terminal 3xFLAG-GFP tag;...
CG Number: CG11254
Gene: Maelstrom
Link Julius Brennecke IMBA Tagged construct available
313145 JB-STOCK w; ; pGLKD>fs(1)Yb_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG2706
Gene: female sterile (1) Yb
Link Julius Brennecke IMBA RNAi lines available
313481 JB-STOCK w; ;Nxf3_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-97E07 containing the Nxf3 locus with C-terminal GFP_Precission_...
CG Number: CG32135
Gene: Nuclear export factor 3
Julius Brennecke IMBA tagged construct available
313497 JB-STOCK w; piRNA-biogenesis-reporter #5/ [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRNA biogenesis reporter available
313408 JB-STOCK ; If/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser; GFP sensor for RNA tethering; GFP expressed under ubiquitous tubulin promote... Link Julius Brennecke IMBA tethering lines available
313586 JB-STOCK w; nanos>GFP-Piwi_vasa3'UTR [attP40]/CyO; pV22>ago3_sh [attP2]/TM3, Ser; based on stocks KS4 (TRiP GL00117) and KS6
CG Number: CG40300
Gene: Argonaute 3
Link Julius Brennecke IMBA RNAi lines available
313199 JB-STOCK w; ; pGLKD>piwi_sh2[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG6122
Gene: piwi
Julius Brennecke IMBA RNAi lines available
313705 JB-STOCK w; papi[1-5-2]; ; papi null allele (frameshift induced by Cas9); sequence: GACATTAGCGGCGTTCCCG...
CG Number: cg7082
Gene: papi
Julius Brennecke IMBA CRISPR line available
313711 JB-STOCK w; TR58/CyO; Sb/TM3, Ser; attP40 landing site, trigger sensor construct TR58, GBlock: GGACGAGCTGTACAAG... Julius Brennecke IMBA sensor line available
313166 JB-STOCK w; ; pW20>mago_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCACCACCTCAAGCATAGCCTAta...
CG Number: CG9401
Gene: mago nashi
Link Julius Brennecke IMBA RNAi lines available
313222 JB-STOCK hs-hid(Y); tj Gal4, gyspsy_lacZ/CyO; ; soma screen stock; published in Olivieri et al. (2010)
Gene: gypsy
Link Julius Brennecke IMBA reporter available
313588 JB-STOCK w; GFP-Nup107/CyO; pGLKD>white_sh [attP2]/TM3, Ser; based on stocks KS12 and FM44
CG Number: CG2759
Gene: white
Link Julius Brennecke IMBA RNAi lines available
313189 JB-STOCK w; ; pGLKD>spnE_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG3158
Gene: spindle E
Link Julius Brennecke IMBA RNAi lines available
313316 JB-STOCK w; ; papi_GFP/Precission/V5/3xFLAG [attP2]/TM3,Sb; Pacman CH322-41G09 containing the papi locus with C-terminal GFP_Precission_...
CG Number: CG7082
Gene: papi
Link Julius Brennecke IMBA Tagged construct available
313467 JB-STOCK w; If/CyO; piRNA-biogenesis-reporter #31 [attP2]/TM3,Ser ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRNA biogenesis reporter available
313693 JB-STOCK w; pW22>zuc_sh1[attp40]/CyO; Sb/TM3,Ser; attP40 landing site, same sequence as TRIP #GL00111, but the knockdown is we...
CG Number: cg12314
Gene: zucchini
Julius Brennecke IMBA shmiR line available
313723 JB-STOCK UAS Dcr-2(X),hs-hid(Y); NGT-Gal4-VP16; nos-GAL4, nos>GFP_lacZ_HeT-A_700/Ser; germline HeT-A sensor; based on stock 537; target sequence shorter than the ...
Gene: HeT-A
Julius Brennecke IMBA reporter available
313396 JB-STOCK ; pUASp>LacI_Mael [attP40]/CyO; lacO_nos>GFP-Piwi (with intron) [attP2]/TM3, Ser; cross to germline specific Gal4 for tethering Mael to upstream of nanos prom...
CG Number: CG11254
Gene: Maelstrom
Julius Brennecke IMBA tethering lines available
313514 JB-STOCK w; piwi[1], Bac(GFP-Piwi[deltaNLS] #2) attP40/CyO; ; piwi[1] allele with genomic rescue construct in attP40 expressing GFP-Piwi w...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA tagged construct available
313176 JB-STOCK w; ; pW20>Patr-1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCACGCCGTATATCGACGACTAta...
CG Number: CG5208
Gene: Protein assoc. topoII rel.-1
Link Julius Brennecke IMBA RNAi lines available
313773 JB-STOCK w; if/CyO; pNASA > Deadlock-vhhGFP[attP2]/TM3,Ser Deadlock nanobody stock for bypass experiment
CG Number: CG9252
Gene: del
Julius Brennecke IMBA Tagged construct available
313495 JB-STOCK w; piRNA-biogenesis-reporter #3 [attp40]/CyO; ; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Link Julius Brennecke IMBA piRNA biogenesis reporter available
313695 JB-STOCK w; If/CyO; pW20>zuc_sh+nbr_sh[attP2]/TM3,Ser; attP2 landing site, 1st zuc_shmiR sequence is identical to GL00111, 2nd nibb...
CG Number: cg12314, cg9247
Gene: zucchini, nibbler
Julius Brennecke IMBA shmiR line available
313163 JB-STOCK w; ; pW20>krimp_sh2[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtCAGATTGGGAGACTACGAATAta...
CG Number: CG15707
Gene: krimper
Link Julius Brennecke IMBA RNAi lines available
313304 JB-STOCK w; Nup54_mCherry/3xHA/Precission/4xMYC [attP40]/CyO; ; Pacman CH322-100D07 containing the Nup54 locus with C-terminal mCherry_3xHA_...
CG Number: CG8831
Gene: Nucleoporin 54
Julius Brennecke IMBA Tagged construct available
313333 JB-STOCK w; BAC{GFP-piwi[cDNA+intron4+int5@504bp_down]_R21} [attP40]/CyO; ; based on construct from stock 344 (plasmid JB93); only intron 4 retained; in...
CG Number: CG6122
Gene: piwi
Link Julius Brennecke IMBA Tagged construct available
313298 JB-STOCK w; 3xFLAG/GFP_mael [attP40]/CyO; ; BAC construct containing the maelstrom locus with N-terminal 3xFLAG-GFP tag;...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA Tagged construct available
313185 JB-STOCK w; ; pW20>sbr_sh1/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtAAGCGATGCTCTCCATATCAAta...
CG Number: CG1664
Gene: small bristles
Link Julius Brennecke IMBA RNAi lines available
313179 JB-STOCK w; If/CyO; pGLKD>qin_sh1[attP2]/TM3,Ser; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG14303
Gene: qin
Link Julius Brennecke IMBA RNAi lines available
313606 JB-STOCK w; piRinternalA-biogenesis-reporter #17 [attp40]/CyO; Sb/TM3, Ser; Gblock cloned into plasmid JB634 (trigger sensor plasmid version 2 from Domi... Julius Brennecke IMBA piRinternalA biogenesis reporter available
313144 JB-STOCK w; ; pGLKD>egg_sh1[attP2]/TM3,Sb; in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo seq...
CG Number: CG12196
Gene: eggless
Link Julius Brennecke IMBA RNAi lines available
313700 JB-STOCK w; nibbler[Cas9 FS allele]/CyO-GFP; ;
CG Number: cg9247
Gene: nibbler
Julius Brennecke IMBA CRISPR line available
313593 JB-STOCK w[1118];; aub [g1]/CyO; ago3 [g2]/TM6B, Tb, Hu; based on stocks KS26 and KS29
CG Number: CG6137, CG40300
Gene: aubergine/Argonaute 3
Link Julius Brennecke IMBA mutant alleles available
313785 JB-STOCK w; ; sbr_GFP_Precission_V5_3xFLAG [attP2]/TM3,Sb; Pacman CH322-120I06 containing the sbr locus with C-terminal GFP_Precission_...
CG Number: CG1664
Gene: small bristles
Julius Brennecke IMBA tagged construct available
313136 JB-STOCK w; ; pW20>Gtsf1_sh1[attP2]/TM3,Sb; vector: pWalium20 (TRIP); sh-oligo sequence: ctagcagtGCCGTGTGATCTACAAAGACAta...
CG Number: CG3893
Gene: Gtsf1
Link Julius Brennecke IMBA RNAi lines available
313709 JB-STOCK w; TR55/CyO; Sb/TM3, Ser; attP40 landing site, trigger sensor construct TR55, Gblock: GGACGAGCTGTACAAG... Julius Brennecke IMBA sensor line available
313998 JB-STOCK w; ; Boot_GFP_Precission_V5_3xFLAG; endogenously tagged (C-terminus) Boot locus; Guide: cttcgCCTTAAATGCAACTTGATG...
CG Number: CG13741
Gene: boot
Julius Brennecke IMBA tagged endogenous genes available
313089 JB-STOCK ; FLAG_GFP_mael-mut[H291A][attP40]/CyO; ; Pacman clone; expresses indicated Maelstrom protein from endogenous regulato...
CG Number: CG11254
Gene: maelstrom
Link Julius Brennecke IMBA tagged construct available

NEW - recently added to our collection

SIMILAR – further resources related to your item of interest, eg. for the same gene.