Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT038334
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206392
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 238334
Nearest Genes
Gene Nr FlyBase ID Distance
CG7508 FBgn0010433 2985 bp
CG11671 FBgn0037562 4932 bp
Sequence Length 2233
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATCGGTCGTTATTCCCGAGCAGCTA
Right Primer TTTTTGTGTTGCCAAATGCGGAA
Template genomic
Sequence ATCGGTCGTT ATTCCCGAGC AGCTACTCCA GCTACCACCT GCATGCAGCT GCACAGCACA GCAGAGATTC GGAGCCTCGA ATTCAGATCC AGCTTCCAAA ATGCAACTGC CTGCCAATAC AATTAGTTAG AATTCATGAA TGGCAACTCG ACCCCAGTCG AGTTCTGGCA TTCTGACTTA CTGGCTCACT GCGTTTCGGC ATTCGGCTTT CAGCTTTCGG CCTTTGGCTT TTGGCAGTGC CGCCGACACA GCAGCAACAT CACGCCGGAA AACAGGAGGA GCAGTAGTGG CAGAAGTGGC AGAAGTGGCA GAAGTGGCAG AAGCGGCAGC CACTTGCATG TCTTTGTCAA TTTATAGACA GCTTGCCTGA GCATTATTAA CACGTATTAT TACGGGTATG CATTCGATGT CCGTTGTGGG GCTGCATATT TTGTGGGTTT TTCTGGCCGT TCGAACGGGG GGAAACGAAT GCCCCCGAAA TTTGTCATGT CGATAATTGG CGAGCTTTAT TTTGAGGTTT TTGAGGTTGC TTATATTTTT TGTGTCCGAC GCTTTGGTTA GTTAGTGCAT CTGTATCTGT AAATGTATGT ACATCTGCGT TAAGTAACTT AATGAGCTTT AACACCATCA ATTTGTCACT TCTTGTTAGT GTCGCCATGG GGCAGTATCT AAATGGGTTA TTGTACCGAT CGACTTGCAT CTTGTTAAGT GGTAAGGTTT TAAGGCTCGT TATGTGCAGA CTATATTGGT CTTAGCTGAA GTTCAAGGAC TTAAGCAGTT TGCTCAACAA ATTGAAAGAA TTTTACAGTG GAGCAAGTTT TTATAGATTA AAACTACCTG AAAATAAAGC GAAATAAACA CTTAGGAAAC AGGTAGTTCT GACAATCCAT TGTGCCCCGT AAGATTCAAT TACCCCAATG CACATTTTTT AATTGCGGTT TTGGTATGTT TTGAAATAAT TTATATGCTA TTTCTATGAA TGTTTTTTTG TTATCTCGCT CAATAGAATT TCTCATGCCT TTTTGGGCAC AATTTCCCTC ATTTTCGAAA GATCTAACCA CAAACATTAC TTTGTATCTT TTTTTGTTTA TTTCTCAAGT GCAGTTTCCG TTTCCGCCGA TTTGTTTTGG CATTGTTGTG TGAACATTTT GCGCTGATCC TTTAATTGTT GCGCAACCTT CGCTGGCGAA ATTGCAGGAA CCCAGGTCCG CAGCCCACGG TCCCAAGGAT TCGGTGATTA ATGCCGGACC TTTCTCCCAA GTCGCGTGTG CAGCGAAATT AGTGGGATTT CGTATTGTGT GTGTGGGCAT CGGCATCCGA TCGGTTTAAG CCAAACTCAA AGTCCGGTCC AAATGAATGC AATTATTAAG TCATAAAACG GACAACGTAA AATGCCAAAG TCTGTAATTA GCGACACCAA ATCACGGCAG CCGCGCCCCC TTTTCTTAAT ACATCCTTTC TCAGCCCATT ATCGGGCATT GTGTGCGGTC CGCGAGGAAA GGAGAGAGAT TACCTGGCAT AGGAAGAGGC AGAGTCCTCT GGAGGTCACC GTTTGTTTTG GGAAGTCCTG GCCCACAAGG TTAGCGGCAA TTAGTCAAAC GATTCGCAAC GCATCTACCA TCAATCAACG TAGGGCCATG GGCTCCGGTT ACCGATCCTG ATCATCATTA TCCTCGTCCT CCTCATCGGG AGCAGTAACA AACTTAACCG TTACCCATTT GACAAATAAT TCGCACGGCC AACGGCCCAA AAATCTCTGG GTAACTCAAT TAGCCACACA GACGATCGGC ACGGCACACT TGACTGACTT TCGGTTTCCA AACCCAAGAG TCCAGATTCA GGACCCACCA AGTTGGTGGG CATCCCAAAG AACCAAAGTT CTCAGTATCT CACGCTGCAG CCAACGGTGA TCGAAGATCG ACAGTGAAAG TGCATCAGAA ATCAAAGTCG TTCTGGATTT TTTGACAACT TTTTGGCGAG GCATCAAATT AACACAAGAG GCAAAAACCT TAAAATGCTA CCAAGACAAG GCACAGAGCA AACAAAAGGC AGCTAAGTGA ATGCATTTTA ATTATACTCT ACTATTTCAA ATTAAATAAT GCAATTAAGT CACAAGATAA TCCTTGTTAC TTTTTATTAC CCATAGTCGT ACTAAAATAG GTTTCGATTT ATGATTTAGA TTTGATTTTT TGATTTGTAG CGGTAGAGTA TTCCGCATTT GGCAACACAA AAA