Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT017409
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205351
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217409
Nearest Genes
Gene Nr FlyBase ID Distance
CG8355 FBgn0003425 22547 bp
Sequence Length 2162
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGAATAAAAAGCGAGTGCAGGGGGA
Right Primer TGTGGCGGGCGAAATGGATG
Template genomic
Sequence TGAATAAAAA GCGAGTGCAG GGGGATGGAT GGTGGCGGTT GCCAGTCACT GATTTACATT TGATACAGAG ACCGAGCCTC GGACTACTTG AACAATCAGA TTCAATTTGT GCCACGCATT CGTTTTCGTT TTCATTTTCA TTTTCTTGAT CTGCCCCCCT GAACAACAAG TGATGGTGAC GATCAAGTGT ACGGCCCCTA CAGTAGATTA TGCTCTATTT GATTTAGGCA TGGATTTTAT TATTATACTT TTGGTGGCTT TATTATTACA ATGGCGCCTC GAGTGCCGAA ACGCAATCTT CATTTATCTC GTATTTATCT TTATCTCGAC TGTGTGGGCT CATCTTCGAA ATGGACAAAC ACAAAAGCTG GGCATTATTT AGTTTGTCGC CGTGTCCCCG GTTTCAACTT GTTTTCGAGG TTACCATAAT AAACAGCCCC ACCTGCGCCA TTCGCGCACA CACATCATTT CCATGTAAAG TTATAAAATG TTTCACAAAT CCATAAAAAC CCAAAAGGTA AAGAATCTGA GGCGTGCGTT TAGGTCCACC CAAATCCCCT GTCCGATCCC ATGCCATACT ATTCCACTCC ATGCCATACC ATACCACTCT ACTCCATTCC ATTCCATGCC ACCAGAATCC CAGGTGCAAT GCGTGTTGCA GTTGAGCTCT CTGCGATGTT GTTGTTTTGT TTCTGCTCCG GCTTTTGTTT TCCGCATTTC GGGTCAGGTA GAGCGGAGCA TCTTCCTCGA CGCCCCTAAA AGCCTTCGCA TTGTTCTCGC CAGTAGAAGT GAAATATGTT GCAGCGAGCA TGCTGCTGCA TCACCGGGAT TAGGACAGGT AAGGTTGTAA ATTTCACCAG CCACGGGAGT CGACCCTGGA GTCAAAAGGT TGACGAGTAA ATGTGGAAAC CCTAGTTCCA GCAAGGAATA AGGGTATACC AAAAAAATGA TAGCCCTCAA GTAATCTCAC AAAGAGGGTA AACAAATCGT TAAGAAAAAT TCATAAATTC GCTAAATTAA TAACATAACA AAACGGCATA ATGACATAAC CAAAGAAATA TCATAATGAA AATCTCTCTT TTACACAAGA AACCATCATA ATTCCCCAAT CCTTGTGACA TAGCAACGCA CTAAAATTAT GGTTAAATTT GCCAAAGCAA GGAAACCCCG GAGTTTATCT GCTAATAACA ATAAAATGCC ATCAATGGTT CGTATTTTGT CAGGCTCAAT AAAAACAACA GCATAAATGA AACATAGCCA CAAAGTACTT TCATTCCGTC ATATGTCTGG CCAATAAAGC GGAAGTTTGG GCCCCCAACC AATGCCCATG GTTGTACATA AATCAAGTTA TTCTTTATTA ATTCTTAGGC GAAGCATAAA GTAAATATCT TCGAGGACTG GCAGACGCAG CAAAGCAAAC ATAAATTTGG AGCTCTATTA ATCTGGAGGT CATAATCCAT CGAACCACCC TCTTTGGGAT ATTTGAAGCG ATGCCTTGGG ATTTGGGATA TATTTTAAAG ACATTTTTAA ATAGAATAGA ATAAATAAAT AAATATCCTT ATAAGAACTT AACTATTGTT AAATTCATGT CAACTTTAAT ATAAAATCAA GTGCATCAAG AAGACATATT TGTCAGCTTC AATTTAAAAG CCAAAATTAC TATTTTGTGA AAATGCCCAA GAACATGCGA CCGATATTGT TAAATGGAAA TTTCTTTGGT CTGCCCCGTG TCCTGTGTCC TTCTGCCCCA GCACCACCAC CCCCCCCCCC CCTCCGTTTA CACTCCAAGT GACGCACACG CATCGTATCA AATTTCATGG CTGCCGCATG GGTGTGCGTG GGTATCTGTG AGTGCTGCGT CGTATCCAGG TTCGTTTCGT ATCTTTTGCT CTTCCACTGG CGGCGTGTTG ATGACAGATT TCGTCCGTCT GTCCGTCCGT CCATCCGTTC GTCGCTGTGT CGTTTCATTT TCGTTTCGTT GAAGTCATTT TTACTCATTT ATTGTCACCG TTAGAGTACG TCAGAGAGTG TGTGTATATA TCCTTACAAG TACTCGGGAA CCCTGCAGGC GGTCATCCAT GGTATTGATT CCACTTCCAT CTCCACTTCC ATTTCCATTT CCATTCCCAT ACCGACTTCC CACATCCATT TCGCCCGCCA CA