Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT040613
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201189
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240613
Nearest Genes
Gene Nr FlyBase ID Distance
CG6225 FBgn0038072 0 bp
CG6234 FBgn0038071 4687 bp
Sequence Length 1874
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGAATTGAAACGAAAGCATTTGCCA
Right Primer CAAATCCAAGCGAACCGCACG
Template genomic
Sequence CGAATTGAAA CGAAAGCATT TGCCATACTG TTTAATTTTA AATGCACTTT AGCCACTAAG AATTTGCAAA AGTTCGACAA AAATATTTAT ATTTAGACTT TTATAGAGTT AAGCTCTTTT TTATTGTGTC TGATGGAAAG TCAGAATAAA TAATTTCGAT TGGTCAACGT GTGGAGTATC TTTTGGGCGG TTTTCCTTAA GCTTGTTGCA TATTTTTTGG CTGAGTAAAT GATTATGTAT GAAATGTATG CCTATTCAGT TCATTCATAA TCCTATGCAA AGAAACTGAA TCTTTATTTT TTTTTTGTTT TATATTTATG TCGACTATAC CTTTAGTAAA TTAAGATAGA CCAAAATTAA ATGAACGAAG CCTGCAGCTA GAAAAACTTT GATATTTGCA AGGCTCTTAG TTAAATAATG TTCGATAATA TTTTGGCTGC TTTGGTAACA GTTTGACGGA AATATTCTGC AAAAGTTATT GCCATTTTGG CATGTCATAA AACTTAAGCC AAAAAACAAT GCCATGTATA TTAACTGTGT AAGTGATGGC CAATTAGTGA AAAAGCTAGT TTTCTGAGGC TACCATGGCA GTTAAGTTCC GTAGTTTAGC CTCCGAGTTA CAAGGTGCAT ATTTGTATGT CCACAACTAC CCATTGGAAA ACTGTTGCAT TATGCATCGG AAAAATATTA AATGTGTGAT TGCTTTGAAG TCAGTTCCCC TGCCCCTCAA GTCCCAAGAT TAGACTAAAG GTCAACCAGA AATGATTTAC GGCTAAGCTA CATAAAAGTC AGAAGAAATG GCACCCGCAC GCCTAATTGC TTGTCAGGCG TATTGATCAA AAGCTCTTTT GCGGGCATTG CGGGCGGCGC TCTTCAAAGT CGATTTTTAA TTAGTTAATA ACAAATGGAG AGCAGGGCGA TCAGAGAGCG GCAATATTAC TTACTGCTCG CTAGCAACAT AATAAACAAG AGCATGCTGA ACTCCCACCC GTCTTCGGTC GGCACTCCCA TCATTTCAAA TGCCGCTCCG CTTTTCATCG GAAAATCGAG TGGCTGTCGC TGTGTAAATG AGCTTAATGA GCGAAATGAA AAGGCGCTCG CTTCGTGACC GAATGAAATA AACAAAACGA TTTTGAGATT AAGAGCTCGT CAATTCGGAT ATGTATTTGT TTACGCCGGA TTATGCAAGC GCCCGCACAG TGGTCTTCGA TTTCGATTTC GGTCGCCCGC CAAAGAATCA ATTTAAAAGC CATAAAACAC CAATTGACAG CCTTATTTTC TCGATTCCAT CGAATCCAAG AGTCAATTGC TTAAGTCGAA CGCCCTGGAT TGGCTCACTT GGAAATCCAG CGACTCAACG ACGTCATTGT CTGCTCGACT TGGCGAACTA AAGTGAAATG TTAGCCGCTC AAAGTCGCCA CAAGTCCATT GTAATAGCCG GGATTGGGTT GCCAAACCAT CCACGGATGA GCAACCACGA CCACTGTGCT GCAGGCGAGA AGAGGAGACT TTTCCCATTT TCTTCCGCAC TTTTGTCTGG CGAGCGTCTA ACGCCAAAGC TCCCGCTCGT GCGCCTTTCG CTCAGCTGTT CCGCTTTTCC CGCCGCATTT TCCGCCGCTT TTCCTCCTGC ACCCCAAGCA CTTATTTTTC CGATTAAACC GTCTATGCAT GCATGCTAGC TAGTCTAGTC TGTCTCTTTC CCTCTCACTC ATACTTACTC ACTGTCCCTC TCCCTTACTC TCTCTCACTC GCTCTGTGGG TGTGTGCCAG CGCTTTTTCA TCTGCCACAC ATTTCGAAAA AAACAAAATA GCAACATCAA AAAGTTTTTT CAGTTTGCTT GTTGCTTTAC ACGCGTGCGG TTCGCTTGGA TTTG