DETAILED VIEW
VDRC ID 9420
Library GD Stocks (GD)
Construct ID 1670
CG Number (r6.01) CG14059
FlyBase gene number FBgn0036690
FlyBase recombinant construct FBtp0028575
FlyBase Reference Reports FBrf0202579
FBrf0214518
FBrf0234812
FBrf0200327
Synonyms dilp8
dILP8
DILP8
Drosophila insulin-like peptide 8
Ilp8
Insulin-like peptide 8
Hairpin Length 235
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGCAAAACGCACAACAAGCATCACTAC
Right Primer CGCTCTAGACAGAAGAACTCCTCCTCGCACTGG
Template genomic
Sequence GCAAAACGCA CAACAAGCAT CACTACATCA GCCGAAGCAG CTATCCAATG GGTGGCTACC TGAAGGTGAC CCGGGAGCAC TTCAATCGCC TCAGCGAACT GGACATCTTT CCGCGCTACA AGCCCATCAA GCCGCACCAC GAAAAGAAGC ATCGCTTCAA GAGGGATCAC TCGAGCAGGT CCTACAACAA CATTCCCTAC TGCTGTCTAA ACCAGTGCGA GGAGGAGTTC TTCTG