DETAILED VIEW
VDRC ID 9126
Library GD Stocks (GD)
Construct ID 3363
CG Number (r6.01) CG10952
FlyBase gene number FBgn0000535
FlyBase recombinant construct FBtp0030777
FlyBase Reference Reports FBrf0214518
FBrf0202579
FBrf0222832
FBrf0220657
FBrf0200327
Synonyms CIKE
eag
Eag
EAG
ether a go-go
ether-a go-go
ether-a-gogo
ether-a-go-go
Ether-a-go-go
Hairpin Length 302
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability sterile
Inserted Chromosome 3
Left Primer CGCGAATTCCGGAGGCGAGGTTGTTAGTGACC
Right Primer CGCTCTAGACGCTGCGACCAATCGAGTACC
Template genomic
Sequence CGGAGGCGAG GTTGTTAGTG ACCCAAAGGT GATCCGAATG AACTACCTAA AGTCGTGGTT CATCATCGAC CTACTGAGCT GCCTGCCATA CGACGTGTTT AACGCGTTCG ATCGGGATGA GGACGGTATC GGTTCCCTGT TCAGTGCCCT CAAGGTCGTC CGCCTTCTGC GTCTGGGGAG GGTGGTGCGA AAACTGGATC GCTACCTGGA GTACGGGGCG GCCATGTTGA TCCTACTGCT CTGCTTCTAC ATGCTGGTGG CCCATTGGCT AGCCTGCATA TGGTACTCGA TTGGTCGCAG CG