DETAILED VIEW
VDRC ID 8595
Library GD Stocks (GD)
Construct ID 3656
CG Number (r6.01) CG13278
FlyBase gene number FBgn0032602
Synonyms pickpocket 17
ppk17
Hairpin Length 390
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGAAGGGATCTGGTCGAGTGGAGTATGT
Right Primer CGCTCTAGAATTTGGGTGCGTGGCTCTGG
Template cDNA
Sequence GAAGGGATCT GGTCGAGTGG AGTATGTTTT TGTTGGTGTC AATGAGGAAA TAGAGATCAA GCTTCAAACC CAATACTTTT CCAATGTTCA GACGCGTGAA GAGGCGTGTT CCGATGATGA GAACTACAGT GACTTAAAGT GTGGTGAACA ATGCATCTGG CAGGATTTAG CCGATAATAT GCAGTGTTCG GGTCCTTGGA TGCATGAGAT TGCAAGTGAG CCCTGCAATG ACTCCCTTTC CATGAGGAAA CTGATATCGG ATTATAAAGA TGTCTATGAA AATGAGGATG ACTTTGACTG TGACTGTGTT CAGCCCTGCC AATCGAGAAT ATACACAACT TTCATTCAGA ACAGAAAGGC CTTTAATCAA CCAGAGCCAC GCACCCAAAT