DETAILED VIEW
VDRC ID 8317
Library GD Stocks (GD)
Construct ID 3325
CG Number (r6.01) CG10362
FlyBase gene number FBgn0030358
Synonyms
Hairpin Length 326
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCAGTCCGTGCTCCCGAATACACC
Right Primer CGCTCTAGAGTCCGCTCAAACTGGGCTTCAC
Template genomic
Sequence AGTCCGTGCT CCCGAATACA CCGGCCTGCA AGTCCAACCT GCTGGCCGGC GACGTTCTGG TGGCCATCGA AGGCAGGCCG GTGACCACCA TTCAGCAGAT CGCCAAGGTG GTCAAGACGC TGCAGGCCAC TGTCTTTAGT CTGCGCATTG AGCGCATTAT TCCTGGAATT ATTCGCAACG ATGCCATACT GGAGGACTTC GAAAAGTACG AGGATATCGG CGATTTGCCA AGTTCGTATC CCTGCCAACC GAAGTTGGAA ACGGATGAGG CTGCAACCGC TGATCCGACA CCCAAGCACC TGGTGGTGAA GCCCAGTTTG AGCGGA