DETAILED VIEW
VDRC ID 51247
Library GD Stocks (GD)
Construct ID 4047
CG Number (r6.01) CG2671
FlyBase gene number FBgn0002121
Synonyms Complementation group 2.1
dlgl
D-LGL
gl
l(2)
l(2) giant larva
l(2) giant larvae
l(2)giant larvae
l(2)gl
l[[2]]gl
L(2)gl
L(2)GL
Lethal (2) giant larva
lethal (2) giant larvae
lethal-2-giant larvae
lethal(2) giant larvae
lethal(2)-giant larvae
lethal(2)giant larvae
Lethal (2) giant larvae
lethal giant larva
lethal giant larvae
lethal- giant-larvae
lethal-giant-larvae
Lethal giant larvae
Lethal-giant-larvae
Lethal Giant Larvae
lethal giant larve
lgl
l-gl
Lgl
LGL
MENE (2L)-B
p127
p127[l(2)gl]
p127l(2)gl
Hairpin Length 334
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCGTTGCTGCCAATCAAAACACTACC
Right Primer CGCTCTAGAGGGGCTATGTATGCTCGCTGGAC
Template genomic
Sequence CGTTGCTGCC AATCAAAACA CTACCGTTTG ACGGCAAACT TAAAAAAGTT TCATCGCTGT GCTGTTCTCT CAGTAAGGAT CTGCTATGGA TTGGAACAGA AGGTGGAAAC ATCTATCAAC TGGATTTACA TACATTTACC ATTAAGGAGC CTGTAATTTA CCATGACGTT GTGCTAGAGC AGGTGCCACC AGCCTACAAG CTAAATCCTG GTGCAATTGA GTCAATCCGC CAACTTCCAA ACTCCCCTAG CAAACTTCTA GTTGCATACA ATCGCGGCCT TTGTGTTTTG TGGGATTTTG AAAGCGCATC TGTCCAGCGA GCATACATAG CCCC