DETAILED VIEW
VDRC ID 49414
Library GD Stocks (GD)
Construct ID 1199
CG Number (r6.01) CG11992
FlyBase gene number FBgn0011469
FBgn0014018
FBgn0024223
Synonyms immune response deficient 4
ird
ird4
l(3)neo36
NFkappaB
NF-kappaB
Nuclear factor NF-kappa-B p110 subunit
rel
Rel
REL
RELI
relish
Relish
RELISH
Rel/NF-kappaB
Rel-p110
Hairpin Length 260
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCGGCGTTGCTAATGTCACCAGTTT
Right Primer CGCTCTAGAAGGTTTTGGGCGTCCGCTTC
Template genomic
Sequence CGGCGTTGCT AATGTCACCA GTTTTGGCAA CATGTACATG GATCACCAGT ACTTTGTGCC CGCTCCGGCC ACTGTGCCAC CGTCCCAAAA CTTTGGATAC CATCAAAATG GCCTGGCATC TGACGGCGAT ATCAAACACG TGCCGCAGCT GCGGATCGTT GAGCAACCGG TGGAGAAGTT CCGCTTTCGG TACAAGAGCG AGATGCATGG AACACATGGA TCGCTAAATG GCGCCAATTC GAAGCGGACG CCCAAAACCT