DETAILED VIEW
VDRC ID 47896
Library GD Stocks (GD)
Construct ID 701
CG Number (r6.01) CG6919
FlyBase gene number FBgn0038980
FBgn0046516
FBgn0046517
Synonyms anon-WO0170980.67
anon-WO0170980.68
DmCG6919
Dmoa2
DmOctBeta1R
oa2
Oa2
OA2
OctBeta1
Octbeta1R
Octopamine beta1 receptor
octopamine receptor 2
Hairpin Length 240
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCAGTCTGTTTCCCTACGCTTTCTACTTCTGT
Right Primer CGCTCTAGACTGCATCTGGGCGTCCGTGGT
Template genomic
Sequence AGTCTGTTTC CCTACGCTTT CTACTTCTGT CGACGTGGCA GGGGGCGAGA CGATGACCGG GATCTGGAGT TCGGCGGTCC CAGCCGACGG GGAACCAATG GAGCCCAACG GACCGGATCC GGATCCGCCG AGATGGCCAA CTGCGTCAAC TCCACGGCCT CGTCGGAGAT ACACATGAGC GTGATGCGTG CCCGCCAGTA TGCCGTCAAT GTCACACCCA CCACGGACGC CCAGATGCAG