DETAILED VIEW
VDRC ID 45883
Library GD Stocks (GD)
Construct ID 784
CG Number (r6.01) CG4280
FlyBase gene number FBgn0011572
FBgn0015924
FBgn0044547
FBgn0051655
FlyBase recombinant construct FBtp0034740
FlyBase Reference Reports FBrf0227720
FBrf0202579
FBrf0214518
FBrf0221456
FBrf0200327
FBrf0224069
FBrf0211145
Synonyms anon-WO0140519.8
Cd36
CD36
CD36-like
CG31655
cqm
cqr
Cqr
croquemort
Croquemort
crq
Crq
CRQ
D-CD36
Hairpin Length 267
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCCGCCAAAGATGAATGTAAACGATG
Right Primer CGCTCTAGAAGGGAAGGAGGAGTAAATGGGTGCT
Template genomic
Sequence CCGCCAAAGA TGAATGTAAA CGATGAGATT ACGATTTTTG CCACCGATGC TTGCAGATTT ATGAACCTCC GGCCCCGGGG CACATACGAG AATCACGGCC TGACCGCCAC TAAGTGGGTA GGCACCGAGG AGACTCTGGA CTCCGGAGAA AACTACCCTA ACCAGGCGTG CTTCTGTGAT GAGGCGCGAT TTGATGAATG TCCCAAGACC GGTGTCGTGG AGTGCAAGGC GTGCCGAGAC AAAGCACCCA TTTACTCCTC CTTCCCT