DETAILED VIEW
VDRC ID 45478
Library GD Stocks (GD)
Construct ID 3208
CG Number (r6.01) CG9904
FlyBase gene number FBgn0029631
FBgn0040336
Synonyms dSeipin
EG:BACR7C10.1
Seipin
Hairpin Length 344
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCAGCACGCCCTGCACCTTTC
Right Primer CGCTCTAGATGGGATGTTGTCGCTCCTCCA
Template genomic
Sequence CAGCACGCCC TGCACCTTTC CGCACGCGCA CGTCTCGCTG ACAAAGAAGC AGCAACTCCT GATGGTTGGC CAGGCGTACA AGGTGATCGT GAACATCGAC ATGCCGGAGT CGCCGCAAAA TCTCGAGCTG GGCATGTTCA TGGTGTGCGC CGAGATGAGG GACTACGACT CGATGCTGAG GGGTCACTCC TGTCGGTCTG CCATGATGCG CTATCGTTCG CCGCTGATCC GCATGATCTC CACGTGGGTC CTGAGTCCGC TCTATGTGCT TGGCTGGAAA GAGGAGTTCC AGCAGGTGCC AGTTGAGATA TTCTCGCGGT ATCTGGAGGA GCGACAACAT CCCA