DETAILED VIEW
VDRC ID 44851
Library GD Stocks (GD)
Construct ID 1434
CG Number (r6.01) CG8127
FlyBase gene number FBgn0000568
FBgn0010914
FBgn0011342
FBgn0011386
FBgn0011430
FBgn0011438
FBgn0013628
FBgn0043377
FBgn0046398
FBgn0046399
FBgn0047288
Synonyms 57B
75B
anon-WO0172774.31
anon-WO0172774.32
BcDNA:GM02640
dE75
DmE75A
DmE75B
E75
E75A
E75B
E75C
E75-C
E75 nuclear receptor
ecdysone-induced protein 75
Ecdysone-induced protein 75B
Ecdysone inducible protein 75B
Eip75
Eip75 A
eip75B
Eip75B
EP1121b
l(3)07041
l(3)j11A6
l(3)j12E8
l(3)j3A6
l(3)j5E1
l(3)neo25
NR1D3
Rev-Erb
Hairpin Length 279
ON Targets 1
OFF Targets 1
s19 0.99
CAN Repeats 3
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCCCTGTTCTGCGCCATCGTTCT
Right Primer CGCTCTAGAGTCGCTGTTGTTGCCGTCCTC
Template genomic
Sequence CCTGTTCTGC GCCATCGTTC TGATTACGCC GGATCGCCCC GGTTTGCGCA ACCTGGAGCT GATCGAGAAG ATGTACTCGC GACTCAAGGG CTGCCTGCAG TACATTGTCG CCCAGAATAG GCCCGATCAG CCCGAGTTCC TGGCCAAGTT GCTGGAGACG ATGCCCGATC TGCGCACCCT GAGCACCCTG CACACCGAGA AACTGGTAGT TTTCCGCACC GAGCACAAGG AGCTGCTGCG CCAGCAGATG TGGTCCATGG AGGACGGCAA CAACAGCGA